TotalSeq™-A0570 anti-mouse/rat CD29 Antibody

Pricing & Availability
Clone
HMβ1-1 (See other available formats)
Other Names
integrin β1, VLA-β chain, β1 integrin, GPIIa, ITGB1
Isotype
Armenian Hamster IgG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
102233 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD29 is a 130 kD protein, also known as integrin β1, VLA-β chain, or GPIIa. It is a member of the integrin family, expressed broadly on leukocytes, endothelial cells, smooth muscle, and epithelial cells. In association with CD49a-f, CD29 forms the VLA-1 through VLA-6 complexes, respectively. It plays an important role in cell-cell or cell-matrix interaction. The HMß1-1 antibody reacts with both mouse and rat CD29. It is able to block cell adhesion and inhibit T cell proliferation.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse, Rat
Antibody Type
Monoclonal
Host Species
Armenian Hamster
Immunogen
Purified mouse VLA-4 (α4β1, CD49d/CD29)
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation1, immunohistochemistry4 of acetone-fixed frozen sections, in vitro blocking of the adhesion of mouse tumor cell lines to extracellular matrix proteins and in vitro inhibition of T cell proliferative responses1, and in vivo inhibition of neutrophil migration2. The LEAF™ purified antibody (Endotoxin <0.1 EU/μg, Azide-Free, 0.2 μm filtered) is recommended for functional assays (Cat. No. 102210).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone HMβ1-1 is ACGCATTCCTTGTGT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [ACGCATTCCTTGTGT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Noto K, et al. 1995. Int. Immunol. 7:835.
  2. Ridger VC, et al. 2001. J. Immunol. 166:3484.
  3. Jia W, et al. 2005. Blood 106:3854.PubMed
  4. Economopoulou M, et al. 2005. Blood 106:3831.
  5. Lawson BR, et al. 2007. J. Immunol. 178:5366.
  6. Eisenmann KM, et al. 2007. J. Biol. Chem. doi:10.1074/jbc.M703243200.PubMed
  7. Hayashi Y, et al. 2008. Am J Physiol Gastrointest Liver Physiol. 294:G778. PubMed
  8. Kim DT, et al. 2008. Blood 111:2929.PubMed
  9. Hayashi Y, et al. 2008. J Pharmacol Exp Ther. 326:523. PubMed
  10. Carlson TR, et al. 2008. Development. 135:2193. PubMed
  11. Sangaletti S, et al. 2008. Cancer Res. 68:9050. (Block) PubMed
  12. Baker CM, et al. 2012. PNAS. PubMed.
  13. Hirokawa Y, et al. 2014. Am J Physiol Gastrointerest Liver Physiol. 306:547. PubMed
RRID
AB_2783042 (BioLegend Cat. No. 102233)

Antigen Details

Structure
Integrin family, 130 kD
Distribution

Leukocytes, endothelial cells, smooth muscle, epithelial cells

Function
Adhesion
Ligand Receptor
Extracellular matrix
Cell Type
Endothelial cells, Epithelial cells, Leukocytes, Mesenchymal Stem Cells, Embryonic Stem Cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Innate Immunity, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Noto K, et al. 1995. Int. Immunol. 7:835.
2. Springer TA. 1990. Nature 346:425.

Gene ID
16412 View all products for this Gene ID 24511 View all products for this Gene ID
UniProt
View information about CD29 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 10/15/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account