BioLegend TotalSeq
Antibody-oligonucleotide conjugates are required in a number of expanding applications, particularly in single cell multiomics where extensive data sets can be generated at the molecular level from a single cell. Cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) combines scRNA-Seq and Proteomics in one application, to quantify RNA and protein at the same time. This page explores the capabilities of custom antibody-oligo conjugations, and their applications.
TotalSeq™ Barcodes   Overview   CITE-seq workflow and data   Cell Hashing   Inquiry Form
TotalSeq™ -A Products

Sequences in the table below were designed to work with Illumina sequencers and the 10X Genomics platform but should work in any other droplet-based cell-isolation system. The full name of the product includes the associated platform, the barcode identifier, and the target molecule. For example, a conjugated antibody against human CD80 would be named TotalSeq™-A0005 anti-human CD80. Barcodes are clone-specific. The full sequence of the oligonucleotide includes a PCR handle (CCTTGGCACCCGAGAATTCCA), the 15 bp barcode in the table below, and a poly A tail (BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A).

The oligonucleotide sequence for a readily available anti-mouse CD4 conjugate, clone RM4-5, is CCTTGGCACCCGAGAATTCCAAACAAGACCCTTGAGBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A. The name of this product is TotalSeq™-A0001 anti-mouse CD4.

Search by specificity or clone name

Download Table
CategoryBarcode ▼Specificity ▼Clone ▼Reactivity ▼Barcode sequence
TotalSeq™-A3CD366 (Tim-3)RMT3-23MouseATTGGCACTCAGATG
TotalSeq™-A7CD274 (B7-H1, PD-L1)29E.2A3HumanGTTGTCCGACAATAC
TotalSeq™-A8CD273 (B7-DC, PD-L2)24F.10C12HumanTCAACGCTTGGCTAG
TotalSeq™-A10CD276 (B7-H3)DCN.70HumanGACTGGGAGGGTATT
TotalSeq™-A12CD117 (c-kit)2B8MouseTGCATGTCATCGGTG
TotalSeq™-A22CD137L (4-1BB Ligand)5F4HumanATTCGCCTTACGCAA
TotalSeq™-A24CD112 (Nectin-2)TX31HumanAACCTTCCGTCTAAG
TotalSeq™-A60CD90 (Thy1)5E10HumanGCATTGTACGATTCA
TotalSeq™-A61CD117 (c-kit)104D2HumanAGACTAATAGCTGAC
TotalSeq™-A71CD194 (CCR4) L291H4HumanAGCTTACCTGCACGA
TotalSeq™-A88CD279 (PD-1)EH12.2H7HumanACAGCGCCGTATTTA
TotalSeq™-A90Mouse IgG1, κ isotype CtrlMOPC-21GCCGGACGACATTAA
TotalSeq™-A91Mouse IgG2a, κ isotype CtrlMOPC-173CTCCTACCTAAACTG
TotalSeq™-A92Mouse IgG2b, k Isotype CtrlMPC-11ATATGTATCACGCGA
TotalSeq™-A95Rat IgG2b, κ Isotype CtrlRTK4530GATTCTTGACGACCT
TotalSeq™-A101CD335 (NKp46)9E2HumanACAATTTGAACAGCG
TotalSeq™-A107CD21/CD35 (CR2/CR1)7E9MouseGGATAATTTCGATCC
TotalSeq™-A116Ly-6G/Ly-6C (Gr-1)RB6-8C5MouseTAGTGTATGGACACG
TotalSeq™-A119Siglec H551MouseCCGCACCTACATTAG
TotalSeq™-A120TCR β chain H57-597MouseTCCTATGGGACTCAG
TotalSeq™-A122TER-119/Erythroid CellsTER-119MouseGCGCGTTTGTGCTAT
TotalSeq™-A126CD133Clone 7HumanTGGTAACGACAGTCC
TotalSeq™-A130Ly-6A/E (Sca-1)D7MouseTTCCTTTCCTACGCA
TotalSeq™-A131Cadherin 1116G5HumanCGTTGCCATTAACCA
TotalSeq™-A133CD340 (erbB2/HER-2)24D2HumanCTGTAGCCGCCTATT
TotalSeq™-A135CD324 (E-Cadherin)67A4HumanATCCTTCTCCCTTTC
TotalSeq™-A148CD197 (CCR7)G043H7HumanAGTTCAGTCAACCGA
TotalSeq™-A155CD107a (LAMP-1) H4A3HumanCAGCCCACTGCAATA
TotalSeq™-A165CD314 (NKG2D) 1D11HumanCGTGTTTGTTCCTCA
TotalSeq™-A169CD366 (Tim-3)F38-2E2HumanTGTCCTACCCAACTT
TotalSeq™-A171CD278 (ICOS) C398.4AHumanCGCGCACCCATTAAA
TotalSeq™-A172CD275 (B7-H2, B7-RP1, ICOSL)9F.8A4HumanGTTAGTGTTAGCTTG
TotalSeq™-A177CD178 (Fas-L)NOK-1HumanCCGGTCCTCTGTATT
TotalSeq™-A189CD244 (2B4)C1.7HumanTCGCTTGGATGGTAG
TotalSeq™-A195CD134 (OX-40)OX-86MouseCTCACCTACCTATGG
TotalSeq™-A198CD127 (IL-7Rα) A7R34MouseGTGTGAGGCACTCTT
TotalSeq™-A202CD64 (FcγRI) X54-5/7.1MouseAGCAATTAACGGGAG
TotalSeq™-A203CD150 (SLAM) TC15-12F12.2MouseCAACGCCTAGAAACC
TotalSeq™-A354TCR Vβ5.1, 5.2MR9-4MouseCTCAACAGTATTCTG
TotalSeq™-A355CD137 (4-1BB)4B4-1HumanCAGTAAGTTCGGGAC
TotalSeq™-A360CD357 (GITR)108-17HumanACCTTTCGACACTCG
TotalSeq™-A361CD59p282 (H19)HumanAATTAGCCGTCGAGA
TotalSeq™-A363CD124 (IL-4Rα) G077F6HumanCCGTCCTGATAGATG
TotalSeq™-A368CD226 (DNAM-1)11A8HumanTCTCAGTGTTTGTGG
TotalSeq™-A370CD303 (BDCA-2)201AHumanGAGATGTCCGAATTT
TotalSeq™-A375IgG Fc M1310G05HumanCTGGAGCGATTAGAA
TotalSeq™-A390CD127 (IL-7Rα)A019D5HumanGTGTGTTGTCCTATG
We are glad to see that you are just as excited as we are to launch this new product line. As we build our portfolio of oligo conjugated antibodies we are collecting information regarding clone and target preferences so we can prioritize our pipeline. Please use this form to tell us which targets, clones and applications you would be interested to see in our catalog.

       (*denotes required field)

*First Name
*Last Name
Job Title
PI Name
Address 1
Address 2
Postal/Zip Code
Phone Number
*Email Address
Accelerate your discovery with BioLegend.
*Sign up for New Product and Promotion emails:
Your personal data will be handled according to our Privacy Policy. We will never sell your data to anyone. To view, edit, or delete your preferences or personal information, please fill out our Privacy Request Form.

Notes on using the form.
Our standard size is 10µg. We can provide other sizes upon request. Please indicate in the appropriate fields other specific requirements such as required formulation, concentration, etc.
Select application:
Target molecule:
Biolegend clone:
parent clone options
     Privacy Policy
Forgot your password? Reset Password
Request an Account