TotalSeq™-D0156 anti-human CD95 (Fas) Antibody

Pricing & Availability
DX2 (See other available formats)
Regulatory Status
VI C-64
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
305659 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD95 is a 45 kD single chain type I glycoprotein also known as Fas, APO-1, and TNFRSF6. It is a member of the TNF receptor superfamily. CD95 is expressed on T and B lymphocytes, monocytes, neutrophils, and fibroblasts. CD95 expression is upregulated by activation. The extracellular region of CD95 binds to CD178 (Fas ligand). CD178 binding to CD95 induces apoptosis and has been shown to play a role in the maintenance of peripheral tolerance.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Pigtailed Macaque, Sooty Mangabey
Antibody Type
Host Species
CD95 transfected L cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The DX2 antibody is useful for inducing apoptosis of Fas-positive cells. Additional reported applications (for the relevant formats) include: in vitro induction of apoptosis3 (DX2 antibody is required to be cross-linked for effective induction of apoptosis) and immunohistochemical staining4,5 of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 305655 and 305656).

Note: EOS9.1 antibody can induce apoptosis without cross-linking.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds.1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York.
  3. Cifone M, et al. 1994. J. Exp. Med. 180:1547. (Apop)
  4. Zietz C, et al. 2001. Am. J. Pathol. 159:963. (IHC)
  5. Sergi C, et al. 2000. Am. J. Pathol. 156:1589. (IHC)
  6. Xie S, et al. 2010. J. Immunol. 184:2289. (FC) PubMed
  7. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  8. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
  9. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  10. Dixit N, et al. 2012. J. Immunol. 189:5954. PubMed
AB_2892366 (BioLegend Cat. No. 305659)

Antigen Details

TNFR superfamily, type I transmembrane protein, 45 kD

T cells and B cells, monocytes, neutrophils, fibroblasts, expression level upregulated on activated lymphocytes

Mediates apoptosis
Fas ligand (CD178)
Cell Type
B cells, Fibroblasts, Lymphocytes, Monocytes, Neutrophils, T cells
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Neuroscience
Molecular Family
CD Molecules
Antigen References

1. Krammer P, et al. 1994. Immunol. Rev. 142:175.
2. Nagata S, et al. 1995. Science 267:1449.

Gene ID
355 View all products for this Gene ID
View information about CD95 on

Other Formats

View All CD95 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD95 (Fas) DX2 FC
Biotin anti-human CD95 (Fas) DX2 FC
FITC anti-human CD95 (Fas) DX2 FC
PE anti-human CD95 (Fas) DX2 FC
PE/Cyanine5 anti-human CD95 (Fas) DX2 FC
Purified anti-human CD95 (Fas) DX2 FC,ICC,IHC
Alexa Fluor® 488 anti-human CD95 (Fas) DX2 FC
Alexa Fluor® 647 anti-human CD95 (Fas) DX2 FC
Brilliant Violet 421™ anti-human CD95 (Fas) DX2 FC
Pacific Blue™ anti-human CD95 (Fas) DX2 FC
PE/Cyanine7 anti-human CD95 (Fas) DX2 FC
Brilliant Violet 605™ anti-human CD95 (Fas) DX2 FC
PerCP/Cyanine5.5 anti-human CD95 (Fas) DX2 FC
Purified anti-human CD95 (Fas) (Maxpar® Ready) DX2 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD95 (Fas) DX2 FC
APC/Fire™ 750 anti-human CD95 (Fas) DX2 FC
APC/Cyanine7 anti-human CD95 (Fas) DX2 FC
Brilliant Violet 510™ anti-human CD95 (Fas) DX2 FC
Brilliant Violet 711™ anti-human CD95 (Fas) DX2 FC
Brilliant Violet 785™ anti-human CD95 (Fas) DX2 FC
Brilliant Violet 650™ anti-human CD95 (Fas) DX2 FC
Alexa Fluor® 700 anti-human CD95 (Fas) DX2 FC
TotalSeq™-A0156 anti-human CD95 (Fas) DX2 PG
TotalSeq™-C0156 anti-human CD95 (Fas) DX2 PG
TotalSeq™-B0156 anti-human CD95 (Fas) DX2 PG
Ultra-LEAF™ Purified anti-human CD95 (Fas) DX2 FC,ICC,IHC,Apop
TotalSeq™-D0156 anti-human CD95 (Fas) DX2 PG
PE/Fire™ 640 anti-human CD95 (Fas) DX2 FC
KIRAVIA Blue 520™ anti-human CD95 (Fas) DX2 FC
APC/Fire™ 810 anti-human CD95 (Fas) Antibody DX2 FC
PE anti-human CD95 DX2 FC
Spark YG™ 593 anti-human CD95 (Fas) DX2 FC
PE/Fire™ 700 anti-human CD95 (Fas) DX2 FC
PerCP/Fire™ 780 anti-human CD95 (Fas) DX2 FC
Spark Blue™ 574 anti-human CD95 (Fas) DX2 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.


This product is supplied subject to the terms and conditions, including the limited license, located at ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.


BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account