TotalSeq™-D0073 anti-mouse/human CD44 Antibody

Pricing & Availability
IM7 (See other available formats)
Regulatory Status
Other Names
Hermes, Pgp-1, H-CAM, HUTCH-1, ECMR III, gp85, Ly-24
Rat IgG2b, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
103075 10 µg £253
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD44 is a 80-95 kD glycoprotein also known as Hermes, Pgp1, H-CAM, or HUTCH. It is expressed on all leukocytes, endothelial cells, hepatocytes, and mesenchymal cells. As B and T cells become activated or progress to the memory stage, CD44 expression increases from low or mid levels to high levels. Thus, CD44 has been reported to be a valuable marker for memory cell subsets. High CD44 expression on Treg cells has been associated with potent suppressive function via high production of IL-10. CD44 is an adhesion molecule involved in leukocyte attachment to and rolling on endothelial cells, homing to peripheral lymphoid organs and to the sites of inflammation, and leukocyte aggregation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Mouse, Human
Reported Reactivity
Chimpanzee, Baboon, Cynomolgus, Rhesus, Squirrel Monkey, Horse, Cow, Pig, Dog, Cat
Antibody Type
Host Species
Dexamethasone-induced myeloid leukemia M1 cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone IM7 has been reported to recognize an epitope common to alloantigens and all isoforms of CD4417,18 that is located between amino acids 145 and 18620. This clone has been verified for immunocytochemistry (ICC) and frozen immunohistochemistry (IHC-F). Additional reported applications (for the relevant formats) include: immunohistochemistry of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections6,7, complement-mediated cytotoxicity1, immunoprecipitation1,3, in vivo inhibition of DTH4,5, and spatial biology (IBEX)23,24. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 103046, 103065 - 103069).

Cross-reactivity to ferret has been reported by a collaborator, but not verified in house.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Trowbridge IS, et al. 1982. Immunogenetics 15:299. (ICFC, IP, CMCD)
  2. Katoh S, et al. 1994. J. Immunol. 153:3440. (ELISA)
  3. Budd RC, et al. 1987. J. Immunol. 138:3120. (IP)
  4. Camp RL, et al. 1993. J. Exp. Med. 178:497. (Block)
  5. Weiss JM, et al. 1997. J. Cell Biol. 137:1137. (Block)
  6. Frank NY, et al. 2005. Cancer Res. 65:4320. (IHC) PubMed
  7. Cuff CA, et al. 2001. J. Clin. Invest. 108:1031. (IHC)
  8. Lee JW, et al. 2006. Nature Immunol. 8:181.
  9. Zhang N, et al. 2005. J. Immunol. 174:6967. PubMed
  10. Huabiao C, et al. 2005. J. Immunol. 175:591. PubMed
  11. Gui J, et al. 2007. Int. Immunol. 19:1201. PubMed
  12. Wang XY, et al. 2008. Blood 111:2436. PubMed
  13. Kenna TJ, et al. 2008. Blood 111:2091. PubMed
  14. Yamazaki J, et al. 2009. Blood PubMed
  15. Kmieciak M, et al. 2009. J. Transl. Med. 7:89. (FC) PubMed
  16. Chen YW, et al. 2010. Mol. Cancer Ther. 9:2879. PubMed
  17. Zheng Z, et al. 1995. J. Cell. Biol. 130:485.
  18. Wiranowska M, et al. 2010. Int. J. Cancer 127:532.
  19. Hirokawa Y, et al. 2014. Am J Physiol Gastrointerest Liver Physiol. 306:547. PubMed
  20. Sandmaier BM, et al. 1998. Blood 91:3494.
  21. Yang Y, et al. 2015. Hypertension. 65:1047. PubMed
  22. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  23. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  24. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2894689 (BioLegend Cat. No. 103075)

Antigen Details

Variable splicing of CD44 gene generates many CD44 isoforms, 80-95 kD

All leukocytes, epithelial cells, endothelial cells, hepatocytes, mesenchymal cells

Leukocyte attachment and rolling on endothelial cells, stromal cells and ECM
Hyaluronan, MIP-1β, fibronectin, collagen
Cell Type
B cells, Endothelial cells, Epithelial cells, Leukocytes, Mesenchymal cells, Mesenchymal Stem Cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Haynes BF, et al. 1991. Cancer Cells 3:347.
3. Goldstein LA, et al. 1989. Cell 56:1063.
4. Mikecz K, et al. 1995. Nat. Med. 1:558.
5. Hegde V, et al. 2008. J. Leukocyte Biol. 84:134.
6. Liu T, et al. 2009. Biol. Direct 4:40.

Gene ID
12505 View all products for this Gene ID 960 View all products for this Gene ID
View information about CD44 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD44 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse/human CD44 IM7 FC
Biotin anti-mouse/human CD44 IM7 FC, ICC, IHC-P
FITC anti-mouse/human CD44 IM7 FC, ICC, IHC-P
PE/Cyanine5 anti-mouse/human CD44 IM7 FC
Purified anti-mouse/human CD44 IM7 FC, IHC-F, CyTOF®, ELISA, ICC, IHC-P, IP, CMCD, Stim
Brilliant Violet 605™ anti-mouse/human CD44 IM7 FC
PE anti-mouse/human CD44 IM7 FC
Alexa Fluor® 488 anti-mouse/human CD44 IM7 FC, ICC, IHC-P, SB
Alexa Fluor® 647 anti-mouse/human CD44 IM7 FC, ICC, SB
Pacific Blue™ anti-mouse/human CD44 IM7 FC
Alexa Fluor® 700 anti-mouse/human CD44 IM7 FC, SB
PE/Cyanine7 anti-mouse/human CD44 IM7 FC
APC/Cyanine7 anti-mouse/human CD44 IM7 FC
PerCP/Cyanine5.5 anti-mouse/human CD44 IM7 FC
PerCP anti-mouse/human CD44 IM7 FC
Brilliant Violet 421™ anti-mouse/human CD44 IM7 FC, ICC, IHC-P
Brilliant Violet 570™ anti-mouse/human CD44 IM7 FC
Brilliant Violet 785™ anti-mouse/human CD44 IM7 FC
Brilliant Violet 510™ anti-mouse/human CD44 IM7 FC
Ultra-LEAF™ Purified anti-mouse/human CD44 IM7 FC, CyTOF®, ELISA, IHC, IP, CMCD, Stim
Brilliant Violet 650™ anti-mouse/human CD44 IM7 FC
Purified anti-mouse/human CD44 (Maxpar® Ready) IM7 FC, CyTOF®
Alexa Fluor® 594 anti-mouse/human CD44 IM7 ICC, FC, IHC-P, SB
PE/Dazzle™ 594 anti-mouse/human CD44 IM7 FC
Brilliant Violet 711™ anti-mouse/human CD44 IM7 FC
APC/Fire™ 750 anti-mouse/human CD44 IM7 FC
TotalSeq™-A0073 anti-mouse/human CD44 IM7 PG
TotalSeq™-C0073 anti-mouse/human CD44 IM7 PG
TotalSeq™-B0073 anti-mouse/human CD44 IM7 PG
Spark YG™ 570 anti-mouse/human CD44 IM7 FC, IHC-P
Spark YG™ 593 anti-mouse/human CD44 IM7 FC
TotalSeq™-D0073 anti-mouse/human CD44 IM7 PG
Go To Top Version: 1    Revision Date: 07/14/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-mouse/human CD44

  • Biotin anti-mouse/human CD44

  • FITC anti-mouse/human CD44

  • PE/Cyanine5 anti-mouse/human CD44

  • Purified anti-mouse/human CD44

  • Brilliant Violet 605™ anti-mouse/human CD44

  • PE anti-mouse/human CD44

  • Alexa Fluor® 488 anti-mouse/human CD44

  • Alexa Fluor® 647 anti-mouse/human CD44

  • Pacific Blue™ anti-mouse/human CD44

  • Alexa Fluor® 700 anti-mouse/human CD44

  • PE/Cyanine7 anti-mouse/human CD44

  • APC/Cyanine7 anti-mouse/human CD44

  • PerCP/Cyanine5.5 anti-mouse/human CD44

  • PerCP anti-mouse/human CD44

  • Brilliant Violet 421™ anti-mouse/human CD44

  • Brilliant Violet 570™ anti-mouse/human CD44

  • Brilliant Violet 785™ anti-mouse/human CD44

  • Brilliant Violet 510™ anti-mouse/human CD44

  • Ultra-LEAF™ Purified anti-mouse/human CD44

  • Brilliant Violet 650™ anti-mouse/human CD44

  • Purified anti-mouse/human CD44 (Maxpar® Ready)

  • Alexa Fluor® 594 anti-mouse/human CD44

  • PE/Dazzle™ 594 anti-mouse/human CD44

  • Brilliant Violet 711™ anti-mouse/human CD44

  • APC/Fire™ 750 anti-mouse/human CD44

  • TotalSeq™-A0073 anti-mouse/human CD44

  • TotalSeq™-C0073 anti-mouse/human CD44

  • TotalSeq™-B0073 anti-mouse/human CD44

  • Spark YG™ 570 anti-mouse/human CD44

  • Spark YG™ 593 anti-mouse/human CD44

  • TotalSeq™-D0073 anti-mouse/human CD44


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account