TotalSeq™-A0027 anti-human CD70 Antibody

Pricing & Availability
Clone
113-16 (See other available formats)
Other Names
CD27 ligand, CD27L, Ki-24 antigen, Tumor necrosis factor ligand superfamily, member 7 (TNFSF7)
Isotype
Mouse IgG1
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
355117 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD70, also known as CD27L, is a 50 kD type II transmembrane glycoprotein and member of the tumor necrosis factor superfamily. CD70 is expressed on activated T, B and NK cells, activated plasmacytoid dendritic cells (pDCs), and chronic B cell lymphocytic leukemia and large B cell lymphomas. CD70 costimulates T cell proliferation and differentiation. It plays a role in the pDC-induced B cell differentiation. The ligand of CD70 is CD27.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
CD70-transfected L cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications for the relevant formats include: blocking of plasmacytoid dendritic cell induced B cell proliferation and Ig secretion1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone 113-16 is CGCGAACATAAGAAG.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CGCGAACATAAGAAG]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Shaw J, et al. 2010. Blood 115:3051. (Block)
RRID
AB_2749965 (BioLegend Cat. No. 355117)

Antigen Details

Structure
Type II transmembrane glycoprotein, member of the tumor necrosis factor superfamily, 50 kD
Distribution

Activated T cells and B cells, activated NK cells, activated plasmacytoid dendritic cells, some B cell lymphomas

Function
Role in T cell proliferation, generation of cytolytic and memory T cells, B cell proliferation and differentiation
Ligand/Receptor
CD27
Cell Type
B cells, Dendritic cells, NK cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Bowman MR, et al. 1994. J. Immunol. 152:1756.
2. Shaw J, et al. 2010. Blood 115:3051.
3. Keller AM, et al. 2009. Blood 113:5167.

Gene ID
970 View all products for this Gene ID
UniProt
View information about CD70 on UniProt.org

Related FAQs

What is TotalSeq™ and how do they work with established workflows (CITE-seq, and REAP-seq)?

TotalSeq™ is BioLegend’s brand of antibody-oligonucleotide conjugates, to enable simultaneous analysis of proteins and mRNA in single cells. CITE-seq and REAP-seq are two similar workflows to do simultaneous protein and mRNA analysis, and the TotalSeq™ conjugates integrate seamlessly into these workflows.

What’s the benefit of Cell hashing?

Hashing allows customers to run multiple samples in a single lane of a 10x Genomics Chromium instrument, or equivalent, which optimizes the number of cells or samples that can be analysed simultaneously. This can reduce variability due to batch effects, handling, etc. It can also improve yield when cell numbers are low and optimize the use of the platform.

Does co-staining for FACS and TotalSeq™ interfere with the workflow?

We have not tested this, but there is no reason to believe that non-competing clones for the same target would be problematic. Similarly, a sub-saturating concentration of both reagents against the same target should be tolerated by the cell/technique. The original CITE-seq paper by Stoeckius et al.(Fig. 2) demonstrated that cells can be co-stained for downstream analyses. Although the authors did not use current TotalSeq™ reagents, the technology is the same. In addition, other CITE-Seq users have also demonstrated this approach. Please contact our technical service group for more information.

Is it possible to do FACS sorting first then do CITE-Seq, while performing both antibody-oligo and antibody-fluorophore labelling at the same time? Will the oligo conjugate withstand sorting?

The oligo should withstand sorting. However, based on theoretical considerations we recommend to use non-competing clones, to minimize impact in either FACS or sequencing signal/reading. Even if exposed for a very short time, we have not evaluated the effect of ultraviolet or violet lasers on the oligo conjugates. An alternative to flow sorting could be magnetic bead enrichment, such as our MojoSort™ platform.

How many TotalSeq™ antibodies is it possible to multiplex?

A published article multiplexed 82 antibodies conjugated to oligonucleotides. The authors did not use current TotalSeq™ antibodies, but the method is very similar, which they termed REAP-seq. There is no reason to believe that larger panels are not possible.

How many cells do you need per experiment?

This depends on the biological question that needs to be answered. From the technical perspective, when using 10X Genomics Chromium, it is recommended to load 5,000 – 10,000 cells per lane. The use of Hashtags can increase that number. For ease of staining, we typically recommend 1 million cells, but this number also depends on availability of cells and the operator’s ability to handle low cell numbers.

What is the baseline copy number for detection of protein expression (via TotalSeq™ labelling)?

This has to do mostly with antibody affinity, titration, and level of antigen expression. BioLegend and some collaborators are working on titration data. There is also some data already published. In theory, as long as the antibody can bind one molecule, PCR amplification and sequencing should pick it up, but there is always background noise. A common way to control for this is to add negative cells to your experiment. For example, if working with human PBMCs, use mouse cells and vice versa.

Is autofluorescence an issue as in flow cytometry?

No, sequencing as the final readout is not affected by cell autofluorescence.

Can CITE-seq be extended to micro-RNAs?

This is a technically challenging application as micro-RNAs are very small, and in many cases will be as small as or even smaller than the required primers to execute the protocol. It is not possible at the moment.

Is it possible to run CyTOF® and TotalSeq™ (CITE-seq) alongside each other?

Not in the same experiment; it is not possible because CyTOF® requires its own instrument and protocol, and it destroys the sample in the process. To do so, it is necessary to split the sample and run both CyTOF® and CITE-seq assays. Note that CITE-seq generates equivalent data for surface proteins as CyTOF® with higher panel multiplexing capabilities and at a single-cell level.

How is the oligo tag bound to the antibody so that it does not interfere with antibody binding to target protein?

The oligo is attached to the antibody in the same method as some of our fluorophore-conjugated antibodies that are quality tested for flow cytometry. Once the antibodies have been conjugated to the oligonucleotide, we verify by flow cytometry that the antibody can still bind to its target. This is part of our quality control process for TotalSeq™ conjugates.

Is it necessary to sort samples prior to CITE-seq? What should I consider when deciding to pre-sort, or not?

If the populations of interest can be clustered/identified without sorting, the likelihood that you need to pre-sort is minimal. However, if the cell number in the cluster is very small, it may not be sufficient to draw conclusions when compared to control, or other cell populations. In which case, enrichment of this population prior to CITE-seq analysis may help with obtaining more meaningful sequencing data that is selective for your rare cell population(s) of interest. We also recommend to sort out dead cells if the viability in a sample is lower than 95%.

Why is it essential to remove dead cells prior to subjecting samples for CITE-seq?

Running dead cells during CITE-seq essentially leads to “wasting” single cell runs on dead cells, which may ultimately lead to sub-optimal data, or not processing enough cells to pick up the positive events, especially if the frequency of your target cell is very low. Dead cells can also be removed using magnetic particles. If performing CITE-seq before eliminating dead cells is required, it is possible to use bioinformatics methods to try to clean up low quality events (which may include dead cells). This could be a more complex approach, but in such cases, we recommend the following reading:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4758103/
https://www.ncbi.nlm.nih.gov/pubmed/28045081

How can I titrate TotalSeq™ antibodies?

We are still in the process of identifying optimal concentrations for the use of TotalSeq™ reagents. However, here is what we can recommend for titrations:

  1. Performing titrations using the actual CITE-seq method is costly, but using Hashtags can make the process more affordable. See Fig. 3 and associated methods of this publication for more information.
  2. Perform flow cytometry experiments to find the optimal antibody amount, using the same clone conjugated to PE. The flow cytometry antibody amount translates well to the CITE-seq amount.
  3. Label the cells with different concentrations of TotalSeq™ antibody, and then use a poly-dT oligo conjugated to a fluorophore, such as Alexa Fluor® 647, as a secondary reagent to detect the TotalSeq™ antibody. This is a more direct method as compared to the ones listed above, but it requires the use of the actual TotalSeq™ antibody.
Why should I generate ADT/Hashtags libraries separate from mRNA?

To provide flexibility when sequencing. Libraries can be mixed at different ratios before sequencing depending on the number of reads needed.

I need to order primer; where do I order them and what purity is needed?

There are several companies offering primer synthesis. We can recommend IDT technologies. For additive primers, desalt purification is sufficient. For index primers, either HPLC or PAGE is needed.

What tools are available for data analysis?

Cell Ranger 3.0 can be used for barcode count, although some reagents or applications may not be supported by 10x Genomics. Useful resources include CITE-Seq-Count, and the Satija Lab. Please contact our technical service group (tech@biolegend.com) for further information.

What are "Hashtags"?

Hashtag reagents are intended to be used for sample barcoding, which allows users to combine multiple samples into a single lane, then de-multiplex during analysis. Instead of select antigen-specific antibodies, the hashtags are designed so that they are specific for human or mouse cells, and to cover as many cells as possible. For human samples, the hashtags are made of two antibodies that recognize ubiquitous surface markers, CD298 and β2 microglobulin, each conjugated to the same oligonucleotide containing the barcode sequence. For mouse samples, the surface markers are CD45 and H-2 MHC class I. The conjugates are already pre-mixed and ready to use.

Go To Top Version: 1    Revision Date: 07/12/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account