The TotalSeq product suite solution for comprehensive analysis of cellular processes
Our first reagent for proteogenomics applications, TotalSeq™-A oligonucleotide-antibody conjugates, was designed for use with multiple single-cell sequencing platforms that rely on Poly-dT oligonucleotides as mRNA capture method (scRNA-seq). The antibodies integrate in the scRNA-seq workflow as by mimicking a natural mRNA, thanks to the poly-A oligonucleotide embedded in the sequence of the conjugated oligonucleotide. This constitute the capture portion of the oligonucleotide, which also contains a barcode that permanently labels a specific clone, and a PCR handle, which makes the conjugate compatible with Illumina® sequencing reagents and instruments.
We are also now working with compatible partners, and supporting new versions of genomics reagents and solutions, such as the Feature Barcoding technology from 10X Genomics. We now offer our TotalSeq™-B reagents, which are compatible with the Chromium Single Cell Gene Expression Solution (v3)
In addition, as the need to characterize complex systems grows, including specific immune response to pathogens and cancer for example, the study of cell types involved in mounting an adaptive immune response is imperative. To that end, single-cell analysis of T and B cells has increased as these key players will largely define the balance between health and disease. To support research in this field, BioLegend has expanded the TotalSeq™ suite and released compatible conjugates under the name TotalSeq™-C. These antibodies are compatible with the Chromium Single Cell Immune Profiling Solution.
| |
TotalSeq™-A |
TotalSeq™-B |
TotalSeq™-C |
| 10x Genomics compatibility |
Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly-A tail capture method |
Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1 |
Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1 |
| PCR handle |
CCTTGGCACCCGAGAATTCCA |
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2 |
CGGAGATGTGTATAAGAGACAGNNNNNNNNNN |
| Capture sequence |
Poly-A [(A)30*A*A3] |
NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A |
NNNNNNNNNCCCATATAAGA*A*A |
| Next Generation Sequencing compatibility |
Compatible with Illumina instruments |
Compatible with Illumina instruments |
Compatible with Illumina instruments |
Notes:
- 10x Genomics Data Analysis Software does not support cell hashing analysis.
- N represents either randomly selected A, C, G, or T.
- These sequences are unique to the TotalSeq™-B and C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). All Totalseq™-B, C, and the NYGC antibodies are compatible with 10X Genomics solutions. However, protocols and additional reagents such as required primers may be different. Please follow our protocols when using TotalSeq™ reagents.
- The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.
Currently, products are guaranteed for 4 months. As we continue to work with this product line, guarantee time will be extended in the future.
Barcodes are placed between the PCR handle and the 3' flanking sequence, and they are clone-specific. 10x Genomics Solutions compatible with TotalSeq™-B and TotalSeq™-C contain all the necessary reagents to process and amplify the oligos derived from BioLegend's products for subsequent Illumina sequencing, meaning there is material to accommodate both RNA and antibody-derived tags (ADT) libraries.
For TotalSeq™-A use on the Single Cell Gene Expression Solution, v2 and v3 Kits, additional reagents for preparation of ADT libraries must be purchased. Please refer to our protocols (General TotalSeq™ and Hashtags) for a detailed reagent list.
The tables below contains barcodes for products available to purchase, as well as conjugates that will released in the future.
Originally, Stoeckius et al. used antibodies conjugated to streptavidin and biotinylated oligonucleotides to link the antibody and the oligonucleotide together. BioLegend is now offering antibodies directly conjugated to oligonucleotides, under our brand name TotalSeq™, to help accelerate single cell genomics and other applications.
