(0)
  • Product Search
  • in Web Pages
  • Advanced Search
Related Products

Related Pages

Uncover unique phenotypes and understand protein expression on a single-cell level with TotalSeq™ oligo-conjugated antibodies. Seamlessly integrate these reagents into existing single-cell sequencing protocols for simultaneous characterization of protein and RNA.  Explore the capabilities of proteogenomic analysis and how TotalSeq™ reagents can enable highly multiplexed single-cell protein studies for novel applications in precision medicine, oncology, immunology, neuroscience, and stem cell research.


TotalSeq™ format antibodies are BioLegend’s proprietary patent pending technology. Contact us if you are interested in partnering with us around this technology.


TotalSeq™ Reagents for Single-Cell Proteogenomics


TotalSeq™ oligo-conjugated antibodies enable measurement of proteins at a single cell level and integrate seamlessly into existing single-cell RNA sequencing workflows, including Drop-Seq and those available from 10x Genomics.


Simultaneous Multiomic Data Generation: Increase the power of single cell experiments by combining proteomic and transcriptomic data.

Reduced Dropouts: In contrast to mRNA, TotalSeq™-derived antibody tags are not highly prone to dropouts, which are essentially false negative readouts.
 

Ultra-High Parameter Protein Detection: Detect hundreds of proteins in a single cell.  A lower dropout rate contributes to enhanced sample clustering and the ability to better identify specific cell types.
 

Diverse applications: With a wide-range of mouse and human targets available, you can use TotalSeq™ antibodies in a variety of research areas, including:

  • Personalized or Precision Medicine
  • Cancer Research
  • Stem Cell Research
  • Basic and Applied Immunology
  • Biomarker Discovery
  • Characterization of New or Rare Cell Types
  • Neuroimmunology
  • Vaccine Research
 
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Explore Additional Resources

Watch our introductory video to understand the basics behind proteogenomics-based applications.

This technology was first described by Stoeckius et al. of the NY Genome Center as they used antibodies coupled with oligonucleotides to simultaneously measure proteins and RNA at a single-cell level. They termed this method Cellular Indexing of Transcriptomes and Epitopes by sequencing or CITE-seq. Learn more about CITE-Seq and other TotalSeq™ applications in one of our webinars.

Watch Webinars

References


The list below contains selected publications referencing TotalSeq™ products, as well as the original CITE-seq (Stoeckius et al.) and REAP-seq (Peterson et al.) papers. Please note, manuscripts appearing in bioRxiv have not undergone a peer-review process.

 

Maier B, et al. A conserved dendritic-cell regulatory program limits antitumour immunity. Nature. 2020; doi: 10.1038/s41586-020-2134-y.

 

Kotliarov Y, et al. Broad immune activation underlies shared set point signatures for vaccine responsiveness in healthy individuals and disease activity in patients with lupus. Nat Med. 2020; doi: 10.1038/s41591-020-0769-8.

 

Mulè M, et al. Normalizing and denoising protein expression data from droplet-based single cell profiling. bioRxiv. doi: 10.1101/2020.02.24.963603

 

Granja et al. Single-cell multiomic analysis identifies regulatory programs in mixed-phenotype acute leukemia. Nat Biotechnol. 2019 Dec; 37: 1458-1465.

 

Kendal et al. Identification of human tendon cell populations in healthy and diseased tissue using combined single cell transcriptiomics and proteomics. bioRxiv doi: 10.1101/2019.12.09/86993

 

Karagiannis et al. Single cell transcriptomics reveals opioid usage evokes widespread suppression of antiviral gene program. bioRxiv doi: 10.1101/630574

 

Gaublomme et al. Nuclei multiplexing with barcoded antibodies for single-nucleus genomics. Nat Communications. 2019 July; 10: 2907.

 

Stoeckius et al. Simultaneous epitope and transcriptome measurement in single cells. Nat Methods. 2017 Sep; 14(9): 865-868.

 

Peterson et al. Multiplexed quantification of proteins and transcripts in single cells. Nat Biotechnol. 2017 Oct; 35(10): 936-939.

 

Discover Antibody-Oligo Formats


Each TotalSeq™ antibody is conjugated to a unique oligonucleotide containing a capture sequence, a clone-specific barcode sequence, and a PCR handle compatible with Illumina® sequencing reagents and instruments. Barcodes are placed between the PCR handle and 3’ flanking sequence. The oligonucleotide sequence that is conjugated to our TotalSeq™ antibodies is also referred to as an Antibody-Derived Tag, or ADT. The oligo sequence that is conjugated to our hashtag reagents is referred to as a Hashtag Oligonucleotide, or HTO.

 

Currently, we offer TotalSeq™-A, -B, and –C formats and continue to work with compatible partners to support new versions of genomics reagents and solutions. All TotalSeq™ products are guaranteed until their expiration date (a minimum of 4 months from the date of receipt).

Understand the Differences between TotalSeq™ Formats


TotalSeq™-A: Designed to work with any sequencing platform that relies on poly-dT oligonucleotides as the mRNA capture method.  TotalSeq™-A antibodies contain a poly-A sequence which mimics a natural mRNA.

 

TotalSeq™-B: Capture sequence is compatible with 10x Genomics Chromium Single Cell Expression Solution 3’ kit with Feature Barcode Technology (v3 or v3.1).

 

TotalSeq™-C: Capture sequence is compatible with the 10x Genomics Chromium Single Cell Immune Profiling Solution (5’) which allows for immune repertoire profiling of T and B cell receptors at a single cell resolution.

10x Genomics Solutions compatible with TotalSeq™-B and –C  antibodies contain all necessary reagents to process and amplify both oligos derived from TotalSeq™ reagents and mRNA. When using TotalSeq™-A reagents with the 10x Genomics Single Cell Gene Expression Solution Kits (v2, v3, v3.1), additional reagents for preparation of libraries must be purchased. Please refer to our protocols for a complete list.

Compare and Contrast TotalSeq™ Formats

 

  TotalSeq™-A TotalSeq™-B TotalSeq™-C
10x Genomics compatibility Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly-A tail capture method Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1 Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1
PCR handle CCTTGGCACCCGAGAATTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2 CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence Poly-A [(A)30*A*A3] NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A4 NNNNNNNNNCCCATATAAGA*A*A4
Next Generation Sequencing compatibility Compatible with Illumina instruments Compatible with Illumina instruments Compatible with Illumina instruments

 

Notes:

  1. 10x Genomics Data Analysis Software does not support cell hashing analysis.
  2. N represents a randomly selected A, C, G, or T.
  3. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.
  4. These sequences are unique to the TotalSeq™-B and -C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). TotalSeq™-B, -C, and the antibodies used by NYGC are all compatible with 10x Genomics solutions but utilize different oligo sequences.  As such, protocols and additional reagents, including required primers, differ between the antibody formats.  Please refer to our protocols when using TotalSeq™ reagents.

Watch How it Works


   

Walk Through the TotalSeq™ Workflow

 

1. Stain cells with TotalSeq™ reagents.

Titrate the antibodies to determine the ideal staining concentration for your sample. All TotalSeq™ reagents can be titrated by flow cytometry using a PE-conjugated format of the same clone.
2. Transfer labeled cells containing Antibody-Derived Tags (ADTs) onto a compatible sequencing platform.

 

This diagram illustrates the CITE-seq workflow using Drop-Seq and TotalSeq™-A reagents. Other compatible methods such as the Chromium platform from 10x Genomics may also be used. 


In step 2c, while TotalSeq™-B and –C reagents use a different capture sequence for hybridization, the overall workflow remains similar.

3. Amplify both cDNA and antibody-derived oligo libraries independently.

4. Pool libraries at the desired ratio for sequencing.

Improved Clustering of Distinct Cell Populations with TotalSeq™ Reagents



 

Clustering of approximately 5,000 CITE-seq single-cell expression profiles of PBMCs reveals distinct cell populations based on transcriptome analysis. The left panel shows a two-dimensional representation (tSNE) of global gene expression relationships among all cells. Major cell types in peripheral blood can be discerned based on marker gene expression as indicated. The right panels show mRNA (blue) and corresponding Antibody-Derived Tag (ADT, green) signal for the CITE-seq antibody panel projected on the tSNE plot. Darker shading corresponds to higher levels measured.

 

Multiplex Samples with Hashtag Antibodies

 

Cell Hashing

To pool multiple samples prior to loading them onto a platform capable of single-cell isolation, try one of our hashtag reagents. Each pre-mixed, ready-to-use hashtag reagent contains a pool of antibodies designed to recognize ubiquitously expressed cell surface markers and is conjugated to a unique barcode. For human samples, our hashtag reagents recognize CD298 and β2-Microglobulin and for mouse samples, hashtag antibodies recognize CD45 and H-2 MHC Class I.

 

Benefits of using cell hashing:

  • Robust multiplet identification.
  • Minimize variability and reduce batch effects between samples.
  • Pool smaller samples to reach minimal cell numbers.

 

Read more about cell hashing and how they can be used to multiplex samples in the initial paper by Stoeckius M, et al.

Nuclei Hashing

In addition to single cell analysis in whole, intact cells, single-nucleus analysis makes it possible to characterize cellular states and physiology in tissues that are challenging to dissociate. This includes tissues that are rich in certain cell types like neurons, adipocytes and muscle cells. Single nuclei analysis can also help when tissue storage is required, as it is difficult to recover and obtain single cell suspensions from archived frozen material.

 

To pool isolated nuclei from different samples, we developed nuclear hashing reagents. Our nuclear hashtag antibodies recognize a family of nuclear pore complex proteins and can cross-react with vertebrate organisms and other invertebrate species, such as Xenopus and yeast.

 

Read more about single nuclei hashing analysis in a Nature Communications paper first describing the technology by Gaublomme, et al.

 

Understand the Differences between Hashtag Formats

 

We offer hashtag reagents in our TotalSeq™-A, B, and –C formats. Hashtag reagents from all formats will function similarly, but the workflow and required primers differ.

 

For TotalSeq™-A reagents, the PCR handle between antibodies and hashtag reagents are different. In practice, this means that you will generate two separate libraries– one for your cell surface markers (referred to as ADTs) and one for hashtag-derived oligos (referred to as HTOs). This is beneficial because the two libraries can be mixed at different ratios prior to sequencing to avoid an excess of reads from the hashtags.

 

For TotalSeq™-B and –C reagents, the PCR handle is the same between both your antibodies of interest and the hashtag antibodies. In practice, this means that the hashtag and antibody libraries must be prepared together. To avoid an excess of HTO readings, we recommend titrating down the hashtag reagents. For more information on how to titrate TotalSeq™ products, read our FAQs.

 

Note: Our TotalSeq™ TBNK panels (available in TotalSeq™-A, -B, and –C formats) have been optimized on human PBMCs. Using lysed whole blood and additional TotalSeq™ antibodies may require further optimizations. Please contact our technical service group for further information.

Simplify your Experiments with TotalSeq™ Panels

 

Remove the need for optimization and minimize variability with our pre-defined TotalSeq™ antibody panels. Each single-use tube contains a pre-titrated amount of lyophilized antibodies.

 

Benefits of using TotalSeq™ Panels:

  • Provided in convenient, single-use tubes.
  • Pre-titrated using optimal concentrations for staining.
  • Reduced cost compared to buying individual antibodies.
  • Minimize variability between experiments, between different labs, and during longitudinal studies.

Identify Major Immune Cell Types with TotalSeq™ Human TBNK Panel


 

Human PBMCs were stained with the TotalSeq™ Human TBNK panel containing TotalSeq™-A antibodies against CD3, CD4, CD8, CD11c, CD14, CD16, CD19, CD45, and CD56 (NCAM).

 

Download and view antibody barcode information for all of our TotalSeq™ reagents.  Check the boxes next to each antibody in your panel to export barcode information for only your antibodies of interest.  Or, select download as excel file to download information for all of our products.

ProductsHere
Insert Note Here
Save Close Clear
Lab Timer
Tools
Login / Register
Forgot your password? Reset password?
Create an Account