Loading...

TotalSeq™-D0393 anti-human CD22 Antibody

Pricing & Availability
Clone
S-HCL-1 (See other available formats)
Regulatory Status
RUO
Other Names
BL-CAM, Siglec-2, Lyb8
Isotype
Mouse IgG2b, κ
Barcode Sequence
GGGTTGTTGTCTTTG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
363525 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD22 is a 130 kD type I transmembrane glycoprotein also known as Siglec-2 and BL-CAM and is a member of the immunoglobulin superfamily (sialoadhesion subgroup). CD22 is expressed in the cytoplasm of pro-B and pre-B cells, and on the surface of mature B and activated B cells, but not on plasma cells. CD22 is present in the B cell receptor complex and associates with SHP-1, Syk, Lck, Lyn, and phospholipase Cγ1. A primary function of CD22 is thought to be in limiting antigen receptor signaling by modulating B cell activation threshold. CD22 has been shown to bind to CD45RO and CD75, although the natural ligands for this molecule remain controversial.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Nitschke L. 2005. Curr. Opin. Immunol. 17:290
  2. Foon Ka, et al. 1986. Blood. 68:297
  3. Schwarting R, et al. 1985. Blood. 65:974
  4. Campana D, et al. 1985. J. Immunol. 134:1524
RRID
AB_2894556 (BioLegend Cat. No. 363525)

Antigen Details

Structure
Ig superfamily, a type I glycosylated integral transmembrane protein, 120-130 kD
Distribution

B cells

Function
Adhesion, B-monocyte and B-T interactions
Ligand/Receptor
CD45RO, CD75
Cell Type
B cells
Biology Area
Immunology
Molecular Family
CD Molecules, Siglec Molecules
Antigen References
  1. Clark E. 1993. J. Immunol. 150:4715.
  2. Shan D, et al. 1995. J. Immunol. 154:4466.
Gene ID
933 View all products for this Gene ID
UniProt
View information about CD22 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/26/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD22

  • Brilliant Violet 421™ anti-human CD22

  • PE anti-human CD22

  • APC anti-human CD22

  • FITC anti-human CD22

  • TotalSeq™-A0393 anti-human CD22

  • TotalSeq™-C0393 anti-human CD22

  • PE/Cyanine7 anti-human CD22

  • PerCP/Cyanine5.5 anti-human CD22

  • TotalSeq™-B0393 anti-human CD22

  • APC/Fire™ 750 anti-human CD22

  • TotalSeq™-D0393 anti-human CD22

ProductsHere
Login/Register
Remember me
Forgot your password? Reset Password
Request an Account