Antibody-oligonucleotide conjugates are required in a number of expanding applications, particularly in single cell multiomics where extensive data sets can be generated at the molecular level from a single cell. Cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) combines scRNA-Seq and Proteomics in one application, to quantify RNA and protein at the same time. This page, along with our TotalSeq™ eBook, explores the capabilities of custom antibody-oligo conjugations and their applications.


TotalSeq™ format antibodies are BioLegend’s proprietary patent pending technology. Contact us if you are interested in partnering with us around this technology.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform

 

 

 

The TotalSeq product suite solution for comprehensive analysis of cellular processes

Our first reagent for proteogenomics applications, TotalSeq™-A oligonucleotide-antibody conjugates, was designed for use with multiple single-cell sequencing platforms that rely on Poly-dT oligonucleotides as mRNA capture method (scRNA-seq). The antibodies integrate in the scRNA-seq workflow as by mimicking a natural mRNA, thanks to the poly-A oligonucleotide embedded in the sequence of the conjugated oligonucleotide. This constitute the capture portion of the oligonucleotide, which also contains a barcode that permanently labels a specific clone, and a PCR handle, which makes the conjugate compatible with Illumina® sequencing reagents and instruments.


We are also now working with compatible partners, and supporting new versions of genomics reagents and solutions, such as the Feature Barcoding technology from 10X Genomics. We now offer our TotalSeq™-B reagents, which are compatible with the Chromium Single Cell Gene Expression Solution (v3)


In addition, as the need to characterize complex systems grows, including specific immune response to pathogens and cancer for example, the study of cell types involved in mounting an adaptive immune response is imperative. To that end, single-cell analysis of T and B cells has increased as these key players will largely define the balance between health and disease. To support research in this field, BioLegend has expanded the TotalSeq™ suite and released compatible conjugates under the name TotalSeq™-C. These antibodies are compatible with the Chromium Single Cell Immune Profiling Solution.   

 

 

  TotalSeq™-A TotalSeq™-B TotalSeq™-C
10x Genomics compatibility Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly-A tail capture method Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1 Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1
PCR handle CCTTGGCACCCGAGAATTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2 CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence Poly-A [(A)30*A*A3] NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A NNNNNNNNNCCCATATAAGA*A*A
Next Generation Sequencing compatibility Compatible with Illumina instruments Compatible with Illumina instruments Compatible with Illumina instruments

 

Notes:

  1. 10x Genomics Data Analysis Software does not support cell hashing analysis.
  2. N represents either randomly selected A, C, G, or T.
  3. These sequences are unique to the TotalSeq™-B and C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). All Totalseq™-B, C, and the NYGC antibodies are compatible with 10X Genomics solutions. However, protocols and additional reagents such as required primers may be different. Please follow our protocols when using TotalSeq™ reagents.
  4. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.

Currently, products are guaranteed for 4 months. As we continue to work with this product line, guarantee time will be extended in the future.

Barcodes are placed between the PCR handle and the 3' flanking sequence, and they are clone-specific. 10x Genomics Solutions compatible with TotalSeq™-B and TotalSeq™-C contain all the necessary reagents to process and amplify the oligos derived from BioLegend's products for subsequent Illumina sequencing, meaning there is material to accommodate both RNA and antibody-derived tags (ADT) libraries. 

For TotalSeq™-A use on the Single Cell Gene Expression Solution, v2 and v3 Kits, additional reagents for preparation of ADT libraries must be purchased. Please refer to our protocols (General TotalSeq™ and Hashtags) for a detailed reagent list.

 

The tables below contains barcodes for products available to purchase, as well as conjugates that will released in the future.

TotalSeq™-A

 

Download as Excel document:
Category Barcode Specificity Clone Reactivity Sequence
TotalSeq™-A 0001 CD4 RM4-5 Mouse AACAAGACCCTTGAG
TotalSeq™-A 0002 CD8a 53-6.7 Mouse TACCCGTAATAGCGT
TotalSeq™-A 0003 CD366 (Tim-3) RMT3-23 Mouse ATTGGCACTCAGATG
TotalSeq™-A 0004 CD279 (PD-1) RMP1-30 Mouse GAAAGTCAAAGCACT
TotalSeq™-A 0005 CD80 2D10 Human ACGAATCAATCTGTG
TotalSeq™-A 0006 CD86 IT2.2 Human GTCTTTGTCAGTGCA
TotalSeq™-A 0007 CD274 (B7-H1, PD-L1) 29E.2A3 Human GTTGTCCGACAATAC
TotalSeq™-A 0008 CD273 (B7-DC, PD-L2) 24F.10C12 Human TCAACGCTTGGCTAG
TotalSeq™-A 0009 CD275 (B7-H2, ICOSL) 2D3 Human GTGCATTCAACAGTA
TotalSeq™-A 0010 CD276 (B7-H3) DCN.70 Human GACTGGGAGGGTATT
TotalSeq™-A 0012 CD117 (c-kit) 2B8 Mouse TGCATGTCATCGGTG
TotalSeq™-A 0013 Ly-6C HK1.4 Mouse AAGTCGTGAGGCATG
TotalSeq™-A 0014 CD11b M1/70 Human, Mouse TGAAGGCTCATTTGT
TotalSeq™-A 0015 Ly-6G 1A8 Mouse ACATTGACGCAACTA
TotalSeq™-A 0016 Galectin-9 9M1-3 Human ACTCACTGGAGTCTC
TotalSeq™-A 0020 CD270 (HVEM, TR2) 122 Human TGATAGAAACAGACC
TotalSeq™-A 0021 CD252 (OX40L) 11C3.1 Human TTTAGTGATCCGACT
TotalSeq™-A 0022 CD137L (4-1BB Ligand) 5F4 Human ATTCGCCTTACGCAA
TotalSeq™-A 0023 CD155 (PVR) SKII.4 Human ATCACATCGTTGCCA
TotalSeq™-A 0024 CD112 (Nectin-2) TX31 Human AACCTTCCGTCTAAG
TotalSeq™-A 0025 Annexin V NA Human GCAGCGTATAAGTCA
TotalSeq™-A 0026 CD47 CC2C6 Human GCATTCTGTCACCTA
TotalSeq™-A 0027 CD70 113-16 Human CGCGAACATAAGAAG
TotalSeq™-A 0028 CD30 BY88 Human TCAGGGTGTGCTGTA
TotalSeq™-A 0029 CD48 BJ40 Human CTACGACGTAGAAGA
TotalSeq™-A 0030 CD277 (BT3.1) BT3.1 Human TACTTCTGGAGCCAG
TotalSeq™-A 0031 CD40 5C3 Human CTCAGATGGAGTATG
TotalSeq™-A 0032 CD154 24-31 Human GCTAGATAGATGCAA
TotalSeq™-A 0033 CD52 HI186 Human CTTTGTACGAGCAAA
TotalSeq™-A 0034 CD3 UCHT1 Human CTCATTGTAACTCCT
TotalSeq™-A 0045 CD4 SK3 Human GAGGTTAGTGATGGA
TotalSeq™-A 0046 CD8 SK1 Human GCGCAACTTGATGAT
TotalSeq™-A 0047 CD56 (NCAM) 5.1H11 Human TCCTTTCCTGATAGG
TotalSeq™-A 0048 CD45 2D1 Human TCCCTTGCGATTTAC
TotalSeq™-A 0049 CD3 SK7 Human TATCCCTTGGGATGG
TotalSeq™-A 0050 CD19 HIB19 Human CTGGGCAATTACTCG
TotalSeq™-A 0051 CD14 63D3 Human CAATCAGACCTATGA
TotalSeq™-A 0052 CD33 P67.6 Human TAACTCAGGGCCTAT
TotalSeq™-A 0053 CD11c S-HCL-3 Human TACGCCTATAACTTG
TotalSeq™-A 0054 CD34 581 Human GCAGAAATCTCCCTT
TotalSeq™-A 0055 CD138 (Syndecan-1) MI15 Human ACTCTTTCGTTTACG
TotalSeq™-A 0056 CD269 (BCMA) 19F2 Human CAGATGATCCACCAT
TotalSeq™-A 0057 β2-microglobulin 2M2 Human CAGCCCGATTAAGGT
TotalSeq™-A 0058 HLA-A,B,C W6/32 Human TATGCGAGGCTTATC
TotalSeq™-A 0060 CD90 (Thy1) 5.00E+10 Human GCATTGTACGATTCA
TotalSeq™-A 0061 CD117 (c-kit) 104D2 Human AGACTAATAGCTGAC
TotalSeq™-A 0062 CD10 HI10a Human CAGCCATTCATTAGG
TotalSeq™-A 0063 CD45RA HI100 Human TCAATCCTTCCGCTT
TotalSeq™-A 0064 CD123 6H6 Human CTTCACTCTGTCAGG
TotalSeq™-A 0066 CD7 CD7-6B7 Human TGGATTCCCGGACTT
TotalSeq™-A 0068 CD105 43A3 Human ATCGTCGAGAGCTAG
TotalSeq™-A 0069 CD201 (EPCR) RCR-401 Human GTTTCCTTGACCAAG
TotalSeq™-A 0070 CD49f GoH3 Human, Mouse TTCCGAGGATGATCT
TotalSeq™-A 0071 CD194 (CCR4) L291H4 Human AGCTTACCTGCACGA
TotalSeq™-A 0072 CD4 RPA-T4 Human TGTTCCCGCTCAACT
TotalSeq™-A 0073 CD44 IM7 Human, Mouse TGGCTTCAGGTCCTA
TotalSeq™-A 0074 CD54 YN1/1.7.4 Mouse ATAACCGACACAGTG
TotalSeq™-A 0075 CD90.2 30-H12 Mouse CCGATCAGCCGTTTA
TotalSeq™-A 0076 CD15 (SSEA-1) MC-480 Human, Mouse GCTAGTTTGTGCTGC
TotalSeq™-A 0077 CD73 TY/11.8 Mouse ACACTTAACGTCTGG
TotalSeq™-A 0078 CD49d R1-2 Mouse CGCTTGGACGCTTAA
TotalSeq™-A 0079 CD200 (OX2) OX-90 Mouse TCAATTCCGGTAGTC
TotalSeq™-A 0080 CD8a RPA-T8 Human GCTGCGCTTTCCATT
TotalSeq™-A 0081 CD14 M5E2 Human TCTCAGACCTCCGTA
TotalSeq™-A 0083 CD16 3G8 Human AAGTTCACTCTTTGC
TotalSeq™-A 0084 CD56 (NCAM) Recombinant QA17A16 Human TTCGCCGCATTGAGT
TotalSeq™-A 0085 CD25 BC96 Human TTTGTCCTGTACGCC
TotalSeq™-A 0087 CD45RO UCHL1 Human CTCCGAATCATGTTG
TotalSeq™-A 0088 CD279 (PD-1) EH12.2H7 Human ACAGCGCCGTATTTA
TotalSeq™-A 0089 TIGIT (VSTM3) A15153G Human TTGCTTACCGCCAGA
TotalSeq™-A 0090 Mouse IgG1, κ isotype Ctrl MOPC-21 N/A GCCGGACGACATTAA
TotalSeq™-A 0091 Mouse IgG2a, κ isotype Ctrl MOPC-173 N/A CTCCTACCTAAACTG
TotalSeq™-A 0092 Mouse IgG2b, κ isotype Ctrl MPC-11 N/A ATATGTATCACGCGA
TotalSeq™-A 0093 CD19 6D5 Mouse ATCAGCCATGTCAGT
TotalSeq™-A 0094 CD3ε 145-2C11 Mouse TAATGCCAGTTGTGC
TotalSeq™-A 0095 Rat IgG2b, κ isotype Ctrl RTK4530 N/A GATTCTTGACGACCT
TotalSeq™-A 0096 CD45 30-F11 Mouse TGGCTATGGAGCAGA
TotalSeq™-A 0097 CD25 PC61 Mouse ACCATGAGACACAGT
TotalSeq™-A 0098 CD135 A2F10 Mouse GTAGCAAGATTCAAG
TotalSeq™-A 0100 CD20 2H7 Human TTCTGGGTCCCTAGA
TotalSeq™-A 0101 CD335 (NKp46) 9.00E+02 Human ACAATTTGAACAGCG
TotalSeq™-A 0102 CD294 (CRTH2) BM16 Human TGTTTACGAGAGCCC
TotalSeq™-A 0103 CD45R/B220 RA3-6B2 Human, Mouse CCTACACCTCATAAT
TotalSeq™-A 0104 CD102 3C4 (MIC2/4) Mouse GATATTCAGTGCGAC
TotalSeq™-A 0105 CD115 (CSF-1R) AFS98 Mouse TTCCGTTGTTGTGAG
TotalSeq™-A 0106 CD11c N418 Mouse GTTATGGACGCTTGC
TotalSeq™-A 0107 CD21/CD35 (CR2/CR1) 7.00E+09 Mouse GGATAATTTCGATCC
TotalSeq™-A 0108 CD23 B3B4 Mouse TCTCTTGGAAGATGA
TotalSeq™-A 0109 CD16/32 93 Mouse TTCGATGCTGGAGCA
TotalSeq™-A 0110 CD43 S11 Mouse TTGGAGGGTTGTGCT
TotalSeq™-A 0111 CD5 53-7.3 Mouse CAGCTCAGTGTGTTG
TotalSeq™-A 0112 CD62L MEL-14 Mouse TGGGCCTAAGTCATC
TotalSeq™-A 0113 CD93 (AA4.1, early B lineage) AA4.1 Mouse GGTATTTCCTGTGGT
TotalSeq™-A 0114 F4/80 BM8 Mouse TTAACTTCAGCCCGT
TotalSeq™-A 0115 FcεRIα 1-Mar Mouse AGTCACCTCGAAGCT
TotalSeq™-A 0116 Ly-6G/Ly-6C (Gr-1) RB6-8C5 Mouse TAGTGTATGGACACG
TotalSeq™-A 0117 I-A/I-E M5/114.15.2 Mouse GGTCACCAGTATGAT
TotalSeq™-A 0118 NK-1.1 PK136 Mouse GTAACATTACTCGTC
TotalSeq™-A 0119 Siglec H 551 Mouse CCGCACCTACATTAG
TotalSeq™-A 0120 TCR β chain H57-597 Mouse TCCTATGGGACTCAG
TotalSeq™-A 0121 TCR γ/δ GL3 Mouse AACCCAAATAGCTGA
TotalSeq™-A 0122 TER-119/Erythroid Cells TER-119 Mouse GCGCGTTTGTGCTAT
TotalSeq™-A 0123 CD326 (Ep-CAM) 9C4 Human TTCCGAGCAAGTATC
TotalSeq™-A 0124 CD31 WM59 Human ACCTTTATGCCACGG
TotalSeq™-A 0125 CD44 BJ18 Human AATCCTTCCGAATGT
TotalSeq™-A 0126 CD133 clone 7 Human TGGTAACGACAGTCC
TotalSeq™-A 0127 Podoplanin NC-08 Human GGTTACTCGTTGTGT
TotalSeq™-A 0128 CD140a (PDGFRα) 16A1 Human ATGCGCCGAGAATTA
TotalSeq™-A 0129 CD140b (PDGFRβ) 18A2 Human CAATGGTTCACTGCC
TotalSeq™-A 0130 Ly-6A/E (Sca-1) D7 Mouse TTCCTTTCCTACGCA
TotalSeq™-A 0131 Cadherin 11 16G5 Human CGTTGCCATTAACCA
TotalSeq™-A 0132 EGFR AY13 Human GCTTAACATTGGCAC
TotalSeq™-A 0133 CD340 (erbB2/HER-2) 24D2 Human CTGTAGCCGCCTATT
TotalSeq™-A 0134 CD146 P1H12 Human CCTTGGATAACATCA
TotalSeq™-A 0135 CD324 (E-Cadherin) 67A4 Human ATCCTTCTCCCTTTC
TotalSeq™-A 0136 IgM MHM-88 Human TAGCGAGCCCGTATA
TotalSeq™-A 0138 CD5 UCHT2 Human CATTAACGGGATGCC
TotalSeq™-A 0139 TCR γ/δ B1 Human CTTCCGATTCATTCA
TotalSeq™-A 0140 CD183 (CXCR3) G025H7 Human GCGATGGTAGATTAT
TotalSeq™-A 0141 CD195 (CCR5) J418F1 Human CCAAAGTAAGAGCCA
TotalSeq™-A 0142 CD32 FUN-2 Human GCTTCCGAATTACCG
TotalSeq™-A 0143 CD196 (CCR6) G034E3 Human GATCCCTTTGTCACT
TotalSeq™-A 0144 CD185 (CXCR5) J252D4 Human AATTCAACCGTCGCC
TotalSeq™-A 0145 CD103 (Integrin αE) Ber-ACT8 Human GACCTCATTGTGAAT
TotalSeq™-A 0146 CD69 FN50 Human GTCTCTTGGCTTAAA
TotalSeq™-A 0147 CD62L DREG-56 Human GTCCCTGCAACTTGA
TotalSeq™-A 0148 CD197 (CCR7) G043H7 Human AGTTCAGTCAACCGA
TotalSeq™-A 0149 CD161 HP-3G10 Human GTACGCAGTCCTTCT
TotalSeq™-A 0151 CD152 (CTLA-4) BNI3 Human ATGGTTCACGTAATC
TotalSeq™-A 0152 CD223 (LAG-3) 11C3C65 Human CATTTGTCTGCCGGT
TotalSeq™-A 0153 KLRG1 (MAFA) SA231A2 Human CTTATTTCCTGCCCT
TotalSeq™-A 0154 CD27 O323 Human GCACTCCTGCATGTA
TotalSeq™-A 0155 CD107a (LAMP-1) H4A3 Human CAGCCCACTGCAATA
TotalSeq™-A 0156 CD95 (Fas) DX2 Human CCAGCTCATTAGAGC
TotalSeq™-A 0157 CD45.2 104 Mouse CACCGTCATTCAACC
TotalSeq™-A 0158 CD134 (OX40) Ber-ACT35 (ACT35) Human AACCCACCGTTGTTA
TotalSeq™-A 0159 HLA-DR L243 Human AATAGCGAGCAAGTA
TotalSeq™-A 0160 CD1c L161 Human GAGCTACTTCACTCG
TotalSeq™-A 0161 CD11b ICRF44 Human GACAAGTGATCTGCA
TotalSeq™-A 0162 CD64 10.1 Human AAGTATGCCCTACGA
TotalSeq™-A 0163 CD141 (Thrombomodulin) M80 Human GGATAACCGCGCTTT
TotalSeq™-A 0164 CD1d 51.1 Human TCGAGTCGCTTATCA
TotalSeq™-A 0165 CD314 (NKG2D) 1D11 Human CGTGTTTGTTCCTCA
TotalSeq™-A 0166 CD66b 6/40c Human AGCTGTAAGTTTCGG
TotalSeq™-A 0167 CD35 E11 Human ACTTCCGTCGATCTT
TotalSeq™-A 0168 CD57 Recombinant QA17A04 Human AACTCCCTATGGAGG
TotalSeq™-A 0169 CD366 (Tim-3) F38-2E2 Human TGTCCTACCCAACTT
TotalSeq™-A 0170 CD272 (BTLA) MIH26 Human GTTATTGGACTAAGG
TotalSeq™-A 0171 CD278 (ICOS) C398.4A Human, Mouse CGCGCACCCATTAAA
TotalSeq™-A 0172 CD275 (B7-H2, B7-RP1, ICOSL) 9F.8A4 Human GTTAGTGTTAGCTTG
TotalSeq™-A 0173 CD206 (MMR) C068C2 Mouse TCAACTCGGTGTTGC
TotalSeq™-A 0174 CD58 (LFA-3) TS2/9 Human GTTCCTATGGACGAC
TotalSeq™-A 0175 CD96 (TACTILE) NK92.39 Human TGGCCTATAAATGGT
TotalSeq™-A 0176 CD39 A1 Human TTACCTGGTATCCGT
TotalSeq™-A 0177 CD178 (Fas-L) NOK-1 Human CCGGTCCTCTGTATT
TotalSeq™-A 0178 CD45.1 A20 Mouse CCTATGGACTTGGAC
TotalSeq™-A 0179 CX3CR1 K0124E1 Human AGTATCGTCTCTGGG
TotalSeq™-A 0180 CD24 ML5 Human AGATTCCTTCGTGTT
TotalSeq™-A 0181 CD21 Bu32 Human AACCTAGTAGTTCGG
TotalSeq™-A 0182 CD3 17A2 Mouse GTATGTCCGCTCGAT
TotalSeq™-A 0184 CD335 (NKp46) 29A1.4 Mouse CCCTTTCACCTCGAA
TotalSeq™-A 0185 CD11a TS2/4 Human TATATCCTTGTGAGC
TotalSeq™-A 0186 IgA HP6123 Human AAGATGTCCGAGCAA
TotalSeq™-A 0187 CD79b (Igβ) CB3-1 Human ATTCTTCAACCGAAG
TotalSeq™-A 0188 CD66a/c/e ASL-32 Human GGGACAGTTCGTTTC
TotalSeq™-A 0189 CD244 (2B4) C1.7 Human TCGCTTGGATGGTAG
TotalSeq™-A 0190 CD274 (B7-H1, PD-L1) MIH6 Mouse TCGATTCCACCAACT
TotalSeq™-A 0191 CD27 LG.3A10 Human, Mouse, Rat CAAGGTATGTCACTG
TotalSeq™-A 0192 CD20 SA275A11 Mouse TCCACTCCCTGTATA
TotalSeq™-A 0193 CD357 (GITR) DTA-1 Mouse GGCACTCTGTAACAT
TotalSeq™-A 0194 CD137 17B5 Mouse TCCCTGTATAGATGA
TotalSeq™-A 0195 CD134 (OX-40) OX-86 Mouse CTCACCTACCTATGG
TotalSeq™-A 0196 CD235ab HIR2 Human GCTCCTTTACACGTA
TotalSeq™-A 0197 CD69 H1.2F3 Mouse TTGTATTCCGCCATT
TotalSeq™-A 0198 CD127 (IL-7Rα) A7R34 Mouse GTGTGAGGCACTCTT
TotalSeq™-A 0199 Siglec-8 7C9 Human CTTCTCCTCAGCAAT
TotalSeq™-A 0200 CD86 GL-1 Mouse CTGGATTTGTGTATC
TotalSeq™-A 0201 CD103 2.00E+07 Mouse TTCATTAGCCCGCTG
TotalSeq™-A 0202 CD64 (FcγRI) X54-5/7.1 Mouse AGCAATTAACGGGAG
TotalSeq™-A 0203 CD150 (SLAM) TC15-12F12.2 Mouse CAACGCCTAGAAACC
TotalSeq™-A 0204 CD28 37.51 Mouse ATTAAGAGCGTGTTG
TotalSeq™-A 0205 CD206 (MMR) 15-2 Human TCAGAACGTCTAACT
TotalSeq™-A 0206 CD169 (Sialoadhesin, Siglec-1) 7-239 Human TACTCAGCGTGTTTG
TotalSeq™-A 0207 CD370 (CLEC9A/DNGR1) 8F9 Human CTGCATTTCAGTAAG
TotalSeq™-A 0208 XCR1 S15046E Human AAGACGCATGTCAAC
TotalSeq™-A 0209 TCR Vγ1.1/Cr4 2.11 Mouse TCGTTTAACCAGCCT
TotalSeq™-A 0210 TCR Vγ3 536 Mouse TCGTGGTCCCTTTCT
TotalSeq™-A 0211 TCR Vγ2 UC3-10A6 Mouse AAGCTGCACCGTAAT
TotalSeq™-A 0212 CD24 M1/69 Mouse TATATCTTTGCCGCA
TotalSeq™-A 0213 Notch 1 MHN1-519 Human AATCTGTAGTGCGTT
TotalSeq™-A 0214 integrin β7 FIB504 Human, Mouse TCCTTGGATGTACCG
TotalSeq™-A 0215 CD268 (BAFF-R) 11C1 Human CGAAGTCGATCCGTA
TotalSeq™-A 0216 CD42b HIP1 Human TCCTAGTACCGAAGT
TotalSeq™-A 0217 CD54 HA58 Human CTGATAGACTTGAGT
TotalSeq™-A 0218 CD62P (P-Selectin) AK4 Human CCTTCCGTATCCCTT
TotalSeq™-A 0219 CD119 (IFN-γ R α chain) GIR-208 Human TGTGTATTCCCTTGT
TotalSeq™-A 0221 anti-IRF5 11F4A09 Human GGTAGCCCTAGAGTA
TotalSeq™-A 0223 anti-RORγ 2F7-2 Human, Mouse TTCCCTACGCCGAAT
TotalSeq™-A 0224 TCR α/β IP26 Human CGTAACGTAGAGCGA
TotalSeq™-A 0225 CD196 (CCR6) 29-2L17 Mouse CTCTCTGCATTCCTC
TotalSeq™-A 0226 CD106 429 (MVCAM.A) Mouse CGTTCCTACCTACCT
TotalSeq™-A 0227 CD122 (IL-2Rβ) 5H4 Mouse GGTATGCGACACTTA
TotalSeq™-A 0228 CD183 (CXCR3) CXCR3-173 Mouse GTTCACGCCGTGTTA
TotalSeq™-A 0229 CD62P (P-selectin) RMP-1 Mouse, Rat TGTGTGCCGTAGACT
TotalSeq™-A 0230 CD8b (Ly-3) YTS156.7.7 Mouse TTCCCTCTATGGAGC
TotalSeq™-A 0231 H-2Kb bound to SIINFEKL 25-D1.16 Mouse CGTTTATGGGATGGG
TotalSeq™-A 0232 MAdCAM-1 MECA-367 Mouse TTGGGCGATTAAGAA
TotalSeq™-A 0233 Notch 3 MHN3-21 Human CTATTGGACGTATCT
TotalSeq™-A 0234 CD68 Y1/82A Human CGGTGTTTGTAGCAA
TotalSeq™-A 0235 TCR Vβ8.1, 8.2 KJ16-133.18 Mouse ACTATCCGTTGTGCT
TotalSeq™-A 0236 Rat IgG1, κ isotype Ctrl RTK2071 N/A ATCAGATGCCCTCAT
TotalSeq™-A 0237 Rat IgG1, λ Isotype Ctrl G0114F7 N/A GGGAGCGATTCAACT
TotalSeq™-A 0238 Rat IgG2a, κ Isotype Ctrl RTK2758 N/A AAGTCAGGTTCGTTT
TotalSeq™-A 0239 anti-rat IgG2a MRG2a-83 Rat CATTAACAGCGCCAA
TotalSeq™-A 0240 Rat IgG2c, κ Isotype Ctrl RTK4174 N/A TCCAGGCTAGTCATT
TotalSeq™-A 0241 Armenian Hamster IgG Isotype Ctrl HTK888 N/A CCTGTCATTAAGACT
TotalSeq™-A 0242 CD192 (CCR2) K036C2 Human GAGTTCCCTTACCTG
TotalSeq™-A 0244 CD102 (ICAM-2) CBR-IC2/2 Human TGACCTTCCTCTCCT
TotalSeq™-A 0245 CD106 STA Human TCACAGTTCCTTGGA
TotalSeq™-A 0246 CD122 (IL-2Rβ) TU27 Human TCATTTCCTCCGATT
TotalSeq™-A 0247 CD267 (TACI) 1A1 Human AGTGATGGAGCGAAC
TotalSeq™-A 0248 CD62E HAE-1f Human CTCCCTGTGGCTTAA
TotalSeq™-A 0249 IRF4 IRF4.3E4 Human, Mouse GGATTTGTATCTCCC
TotalSeq™-A 0250 KLRG1 (MAFA) 2F1/KLRG1 Human, Mouse GTAGTAGGCTAGACC
TotalSeq™-A 0351 CD135 (Flt-3/Flk-2) BV10A4H2 Human CAGTAGATGGAGCAT
TotalSeq™-A 0352 FcεRIα AER-37 (CRA-1) Human CTCGTTTCCGTATCG
TotalSeq™-A 0353 CD41 HIP8 Human ACGTTGTGGCCTTGT
TotalSeq™-A 0354 TCR Vβ5.1, 5.2 MR9-4 Mouse CTCAACAGTATTCTG
TotalSeq™-A 0355 CD137 (4-1BB) 4B4-1 Human CAGTAAGTTCGGGAC
TotalSeq™-A 0356 CD254 (TRANCE, RANKL) MIH24 Human TCCGTGTTAGTTTGT
TotalSeq™-A 0357 CD43 CD43-10G7 Human GATTAACCAGCTCAT
TotalSeq™-A 0358 CD163 GHI/61 Human GCTTCTCCTTCCTTA
TotalSeq™-A 0359 CD83 HB15e Human CCACTCATTTCCGGT
TotalSeq™-A 0360 CD357 (GITR) 108-17 Human ACCTTTCGACACTCG
TotalSeq™-A 0361 CD59 p282 (H19) Human AATTAGCCGTCGAGA
TotalSeq™-A 0362 CD309 (VEGFR2) 7D4-6 Human TTCACGCAGTAAGAT
TotalSeq™-A 0363 CD124 (IL-4Rα) G077F6 Human CCGTCCTGATAGATG
TotalSeq™-A 0364 CD13 WM15 Human TTTCAACGCCCTTTC
TotalSeq™-A 0366 CD184 (CXCR4) 12G5 Human TCAGGTCCTTTCAAC
TotalSeq™-A 0367 CD2 TS1/8 Human TACGATTTGTCAGGG
TotalSeq™-A 0368 CD226 (DNAM-1) 11A8 Human TCTCAGTGTTTGTGG
TotalSeq™-A 0369 CD29 TS2/16 Human GTATTCCCTCAGTCA
TotalSeq™-A 0370 CD303 (BDCA-2) 201A Human GAGATGTCCGAATTT
TotalSeq™-A 0371 CD49b P1E6-C5 Human GCTTTCTTCAGTATG
TotalSeq™-A 0372 CD61 VI-PL2 Human AGGTTGGAGTAGACT
TotalSeq™-A 0373 CD81 (TAPA-1) 5A6 Human GTATCCTTCCTTGGC
TotalSeq™-A 0374 CD98 MEM-108 Human GCACCAACAGCCATT
TotalSeq™-A 0375 IgG Fc M1310G05 Human CTGGAGCGATTAGAA
TotalSeq™-A 0376 CD195 (CCR5) HM-CCR5 Mouse ACCAGTTGTCATTAC
TotalSeq™-A 0377 CD197 (CCR7) 4B12 Mouse TTATTAACAGCCCAC
TotalSeq™-A 0378 CD223 (LAG-3) C9B7W Mouse ATTCCGTCCCTAAGG
TotalSeq™-A 0379 CD62E (E-selectin) RME-1/CD62E Mouse, Rat CTCCCTTTGTAACAT
TotalSeq™-A 0380 rat CD90/mouse CD90.1 OX-7 Mouse, Rat AGTATGGGATGCAAT
TotalSeq™-A 0381 Panendothelial Cell Antigen MECA-32 Mouse CGTCCTAGTCATTGG
TotalSeq™-A 0382 CD177 MEM-166 Human AGTATGGAGCCATAT
TotalSeq™-A 0383 CD55 JS11 Human GCTCATTACCCATTA
TotalSeq™-A 0384 IgD IA6-2 Human CAGTCTCCGTAGAGT
TotalSeq™-A 0385 CD18 TS1/18 Human TATTGGGACACTTCT
TotalSeq™-A 0386 CD28 CD28.2 Human TGAGAACGACCCTAA
TotalSeq™-A 0387 TSLPR (TSLP-R) 1D3 Human CAGTCCTCTCTGTCA
TotalSeq™-A 0388 CD152 UC10-4B9 Mouse AGTGTTTGTCCTGGT
TotalSeq™-A 0389 CD38 HIT2 Human TGTACCCGCTTGTGA
TotalSeq™-A 0390 CD127 (IL-7Rα) A019D5 Human GTGTGTTGTCCTATG
TotalSeq™-A 0391 CD45 HI30 Human TGCAATTACCCGGAT
TotalSeq™-A 0392 CD15 (SSEA-1) W6D3 Human TCACCAGTACCTAGT
TotalSeq™-A 0393 CD22 S-HCL-1 Human GGGTTGTTGTCTTTG
TotalSeq™-A 0394 CD71 CY1G4 Human CCGTGTTCCTCATTA
TotalSeq™-A 0395 B7-H4 MIH43 Human TGTATGTCTGCCTTG
TotalSeq™-A 0396 CD26 BA5b Human GGTGGCTAGATAATG
TotalSeq™-A 0397 CD193 (CCR3) 5.00E+08 Human ACCAATCCTTTCGTC
TotalSeq™-A 0398 CD115 (CSF-1R) 9-4D2-1E4 Human AATCACGGTCCTTGT
TotalSeq™-A 0399 CD204 7C9C20 Human TAGCGAGCCAGATGT
TotalSeq™-A 0400 CD144 (VE-Cadherin) BV9 Human TCCACTCATTCTGTA
TotalSeq™-A 0401 CD301 (CLEC10A) H037G3 Human ACCTAGAAATCAGCA
TotalSeq™-A 0402 CD1a HI149 Human GATCGTGTTGTGTTA
TotalSeq™-A 0403 CD207 (Langerin) 1.00E+03 Human CATTCTTCACGGGAT
TotalSeq™-A 0404 CD63 H5C6 Human GAGATGTCTGCAACT
TotalSeq™-A 0405 CD284 (TLR4) HTA125 Human GCTTAGCTGTATCCG
TotalSeq™-A 0406 CD304 (Neuropilin-1) 12C2 Human GGACTAAGTTTCGTT
TotalSeq™-A 0407 CD36 5-271 Human TTCTTTGCCTTGCCA
TotalSeq™-A 0408 CD172a (SIRPα) 15-414 Human CGTGTTTAACTTGAG
TotalSeq™-A 0409 CD85g (ILT7) 17G10.2 Human TGTCAGTTCCTATGA
TotalSeq™-A 0410 CD38 HB-7 Human CCTATTCCGATTCCG
TotalSeq™-A 0415 P2RY12 S16007D Mouse TTGCTTATTTCCGCA
TotalSeq™-A 0416 CD300LG (Nepmucin) ZAQ5 Mouse CGGTCCGTATCATTT
TotalSeq™-A 0417 CD163 S15049I Mouse GAGCAAGATTAAGAC
TotalSeq™-A 0418 CD243 (ABCB1) 4E3.16 Human TGACCCGACCTTTAG
TotalSeq™-A 0419 CD72 3F3 Human CAGTCGTGGTAGATA
TotalSeq™-A 0420 CD158 (KIR2DL1/S1/S3/S5) HP-MA4 Human TATCAACCAACGCTT
TotalSeq™-A 0421 CD49b HMa2 Mouse CGCGTTAGTAGAGTC
TotalSeq™-A 0422 CD172a (SIRPα) P84 Mouse GATTCCCTTGTAGCA
TotalSeq™-A 0423 MERTK 590H11G1E3 Human TCCTGCATGTACCCA
TotalSeq™-A 0424 CD14 Sa14-2 Mouse AACCAACAGTCACGT
TotalSeq™-A 0426 CD192 (CCR2) SA203G11 Mouse AGTGCGATCTGCAAC
TotalSeq™-A 0427 Folate Receptor β (FR-β) 94b/FOLR2 Human TGTGGCTAGTCAGTT
TotalSeq™-A 0428 TIM-4 9F4 Human CGTCATATAGTATGG
TotalSeq™-A 0429 CD48 HM48-1 Mouse AGAACCGCCGTAGTT
TotalSeq™-A 0430 CD171 (LICAM) L1-OV198.5 Human GATGGACGACAATTC
TotalSeq™-A 0432 anti-CD230 (Prion) 3F4 Human CAGGTCCCTTATTTC
TotalSeq™-A 0433 CD325 (N-Cadherin) 8C11 Human CCTTCCCTTTCCTCT
TotalSeq™-A 0434 anti-Dopamine Receptor D4 2B9/DRD4 Human, Mouse TCTCTGCACCGCTTT
TotalSeq™-A 0435 anti-GABRB3 N87/25 Human, Mouse, Rat GGTGTGAGCAGTTCT
TotalSeq™-A 0436 anti-Biotin 1D4-C5 Biotin CGGTATATCAACAGA
TotalSeq™-A 0437 CD207 4C7 Human, Mouse CGATTTGTATTCCCT
TotalSeq™-A 0438 KCC2 N1/12 Human, Mouse, Rat GAGCTTGTACCGCTT
TotalSeq™-A 0439 CD201 (EPCR) RCR-16 Mouse TATGATCTGCCCTTG
TotalSeq™-A 0440 CD169/Siglec-1 3D6.112 Mouse ATTGACGACAGTCAT
TotalSeq™-A 0441 CD71 RI7217 Mouse ACCGACCAGTAGACA
TotalSeq™-A 0442 Notch 1 HMN1-12 Mouse TCCGGTCACTCAGTA
TotalSeq™-A 0443 CD41 MWReg30 Mouse ACTTGGATGGACACT
TotalSeq™-A 0444 CXCR4 L276F12 Mouse GTCGTGGTGTTGTTC
TotalSeq™-A 0445 anti-TMEM119 A16075D Mouse TCGAACATTTCCAGG
TotalSeq™-A 0446 CD93 VIMD2 Human GCGCTACTTCCTTGA
TotalSeq™-A 0447 CD200 (OX2) OX-104 Human CACGTAGACCTTTGC
TotalSeq™-A 0448 CD204 (Scavenger R1) 1F8C33 Mouse AGCTAGACACGTTGT
TotalSeq™-A 0449 CD326 (Ep-CAM) G8.8 Mouse ACCCGCGTTAGTATG
TotalSeq™-A 0450 IgM RMM-1 Mouse AGCTACGCATTCAAT
TotalSeq™-A 0551 CD301a LOM-8.7 Mouse TGTATTTACTCACCG
TotalSeq™-A 0552 CD304 (Neuropilin-1) 3.00E+12 Mouse CCAGCTCATTCAACG
TotalSeq™-A 0553 CD309 (VEGFR2, Flk-1) Avas12 Mouse ATAAGAGCCCACCAT
TotalSeq™-A 0554 CD309 (VEGFR2, Flk-1) 89B3A5 Mouse AGTTGTCCTGTACGA
TotalSeq™-A 0555 CD36 HM36 Mouse TTTGCCGCTACGACA
TotalSeq™-A 0556 CD370 (CLEC9A, DNGR1) 7H11 Mouse AACTCAGTTGTGCCG
TotalSeq™-A 0557 CD38 90 Mouse CGTATCCGTCTCCTA
TotalSeq™-A 0558 CD55 (DAF) RIKO-3 Mouse ATTGTTGTCAGACCA
TotalSeq™-A 0559 CD63 NVG-2 Mouse ATCCGACACGTATTA
TotalSeq™-A 0560 CD68 FA-11 Mouse CTTTCTTTCACGGGA
TotalSeq™-A 0561 CD79b (Igβ) HM79-12 Mouse TAACTCAGTGCGAGT
TotalSeq™-A 0562 CD83 Michel-19 Mouse TCTCAGGCTTCCTAG
TotalSeq™-A 0563 CX3CR1 SA011F11 Mouse CACTCTCAGTCCTAT
TotalSeq™-A 0564 Folate Receptor β (FR-β) 10/FR2 Mouse CTCAGATGCCCTTTA
TotalSeq™-A 0565 MERTK (Mer) 2B10C42 Mouse AGTAGAGCAACTCGT
TotalSeq™-A 0566 CD301b URA-1 Mouse CTTGCCTTGCGATTT
TotalSeq™-A 0567 Tim-4 RMT4-54 Mouse TGCTGGAGGGTATTC
TotalSeq™-A 0568 XCR1 ZET Mouse, Rat TCCATTACCCACGTT
TotalSeq™-A 0569 CD338 (ABCG2) 5D3 Human TAAGACTTGGCCGTC
TotalSeq™-A 0570 CD29 HMβ1-1 Mouse, Rat ACGCATTCCTTGTGT
TotalSeq™-A 0571 IgD 11-26c.2a Mouse TCATATCCGTTGTCC
TotalSeq™-A 0572 C5L2 1D9-M12 Human ACAATTTGTCTGCGA
TotalSeq™-A 0573 CD140a APA5 Mouse GTCATTGCGGTCCTA
TotalSeq™-A 0574 CD235a (Glycophorin A) HI264 Human AGAGTATGTATGGGA
TotalSeq™-A 0575 CD49a TS2/7 Human ACTGATGGACTCAGA
TotalSeq™-A 0576 CD49d 9F10 Human CCATTCAACTTCCGG
TotalSeq™-A 0577 CD73 (Ecto-5'-nucleotidase) AD2 Human CAGTTCCTCAGTTCG
TotalSeq™-A 0578 CD79a (Igα) HM47 Human CTTATCACCCGCTTT
TotalSeq™-A 0579 CD9 HI9a Human GAGTCACCAATCTGC
TotalSeq™-A 0580 mast cell tryptase AA1 Human ACTGATAGACCCGCT
TotalSeq™-A 0581 TCR Vα7.2 3C10 Human TACGAGCAGTATTCA
TotalSeq™-A 0582 TCR Vδ2 B6 Human TCAGTCAGATGGTAT
TotalSeq™-A 0583 TCR Vγ9 B3 Human AAGTGATGGTATCTG
TotalSeq™-A 0584 TCR Vα24-Jα18 (iNKT cell) 6B11 Human AACTTCTGTGGTAGC
TotalSeq™-A 0586 CD354 (TREM-1) TREM-26 Human TAGCCGTTTCCTTTG
TotalSeq™-A 0588 CD202b (Tie2/Tek) 33.1 (Ab33) Human CGATCCCTTACCTAT
TotalSeq™-A 0589 Ly-6D 49-H4 Mouse ATGTCCTACCTCAAA
TotalSeq™-A 0590 CD305 (LAIR1) NKTA255 Human ATTTCCATTCCCTGT
TotalSeq™-A 0591 LOX-1 15C4 Human ACCCTTTACCGAATA
TotalSeq™-A 0592 CD158b (KIR2DL2/L3, NKAT2) DX27 Human GACCCGTAGTTTGAT
TotalSeq™-A 0594 CD133 S16016B Human GTAAGACGCCTATGC
TotalSeq™-A 0595 CD11a M17/4 Mouse AGAGTCTCCCTTTAG
TotalSeq™-A 0596 ESAM 1G8/ESAM Mouse TATAGTTTCCGCCGT
TotalSeq™-A 0597 CD209 (DC-SIGN) 9E9A8 Human TCACTGGACACTTAA
TotalSeq™-A 0598 CD110 S16017E Human TGTTGTAAGATGCCA
TotalSeq™-A 0599 CD158e1 (KIR3DL1, NKB1) DX9 Human GGACGCTTTCCTTGA
TotalSeq™-A 0600 CD158f (KIR2DL5) UP-R1 Human AAAGTGATGCCACTG
TotalSeq™-A 0801 CD337 (NKp30) P30-15 Human AAAGTCACTCTGCCG
TotalSeq™-A 0802 CD336 (NKp44) P44-8 Human GGGCAATTAGCGAGT
TotalSeq™-A 0803 CD253 (Trail) RIK-2 Human GCCATTCCTGCCTAA
TotalSeq™-A 0804 CD186 (CXCR6) K041E5 Human GACAGTCGATGCAAC
TotalSeq™-A 0805 CD226 (DNAM-1) TX25 Human AGACCAACTCATTCA

 

Jump to Top

No Results Found. Please try a different search term.


 

TotalSeq™-B

Download as Excel document:
Category Barcode Specificity Clone Reactivity Barcode sequence
TotalSeq™-B 0005 CD80 2D10 Human ACGAATCAATCTGTG
TotalSeq™-B 0006 CD86 IT2.2 Human GTCTTTGTCAGTGCA
TotalSeq™-B 0007 CD274 (B7-H1, PD-L1) 29E.2A3 Human GTTGTCCGACAATAC
TotalSeq™-B 0034 CD3 UCHT1 Human CTCATTGTAACTCCT
TotalSeq™-B 0050 CD19 HIB19 Human CTGGGCAATTACTCG
TotalSeq™-B 0054 CD34 581 Human GCAGAAATCTCCCTT
TotalSeq™-B 0063 CD45RA HI100 Human TCAATCCTTCCGCTT
TotalSeq™-B 0072 CD4 RPA-T4 Human TGTTCCCGCTCAACT
TotalSeq™-B 0080 CD8a RPA-T8 Human GCTGCGCTTTCCATT
TotalSeq™-B 0081 CD14 M5E2 Human TCTCAGACCTCCGTA
TotalSeq™-B 0083 CD16 3G8 Human AAGTTCACTCTTTGC
TotalSeq™-B 0084 CD56 (NCAM) Recombinant QA17A16 Human TTCGCCGCATTGAGT
TotalSeq™-B 0085 CD25 BC96 Human TTTGTCCTGTACGCC
TotalSeq™-B 0088 CD279 (PD-1) EH12.2H7 Human ACAGCGCCGTATTTA
TotalSeq™-B 0089 TIGIT (VSTM3) A15153G Human TTGCTTACCGCCAGA
TotalSeq™-B 0090 Mouse IgG1, κ isotype Ctrl MOPC-21 N/A GCCGGACGACATTAA
TotalSeq™-B 0091 Mouse IgG2a, κ isotype Ctrl MOPC-173 N/A CTCCTACCTAAACTG
TotalSeq™-B 0092 Mouse IgG2b, κ isotype Ctrl MPC-11 N/A ATATGTATCACGCGA
TotalSeq™-B 0100 CD20 2H7 Human TTCTGGGTCCCTAGA
TotalSeq™-B 0101 CD335 (NKp46) 9.00E+02 Human ACAATTTGAACAGCG
TotalSeq™-B 0146 CD69 FN50 Human GTCTCTTGGCTTAAA
TotalSeq™-B 0147 CD62L DREG-56 Human GTCCCTGCAACTTGA
TotalSeq™-B 0148 CD197 (CCR7) G043H7 Human AGTTCAGTCAACCGA
TotalSeq™-B 0154 CD27 O323 Human GCACTCCTGCATGTA
TotalSeq™-B 0159 HLA-DR L243 Human AATAGCGAGCAAGTA
TotalSeq™-B 0161 CD11b ICRF44 Human GACAAGTGATCTGCA
TotalSeq™-B 0171 CD278 (ICOS) C398.4A Human, Mouse CGCGCACCCATTAAA
TotalSeq™-B 0355 CD137 (4-1BB) 4B4-1 Human CAGTAAGTTCGGGAC
TotalSeq™-B 0386 CD28 CD28.2 Human TGAGAACGACCCTAA
TotalSeq™-B 0390 CD127 (IL-7Rα) A019D5 Human GTGTGTTGTCCTATG
TotalSeq™-B 0391 CD45 HI30 Human TGCAATTACCCGGAT
TotalSeq™-B 0087 CD45RO UCHL1 Human CTCCGAATCATGTTG
TotalSeq™-B 0392 CD15 (SSEA-1) W6D3 Human TCACCAGTACCTAGT

 

Jump to Top

No Results Found. Please try a different search term.

TotalSeq™-C

Download as Excel document:
Category Barcode Specificity Clone Reactivity Barcode sequence
TotalSeq™-C 0005 CD80 2D10 Human ACGAATCAATCTGTG
TotalSeq™-C 0006 CD86 IT2.2 Human GTCTTTGTCAGTGCA
TotalSeq™-C 0007 CD274 (B7-H1, PD-L1) 29E.2A3 Human GTTGTCCGACAATAC
TotalSeq™-C 0008 CD273 (B7-DC, PD-L2) 24F.10C12 Human TCAACGCTTGGCTAG
TotalSeq™-C 0009 CD275 (B7-H2, ICOSL) 2D3 Human GTGCATTCAACAGTA
TotalSeq™-C 0020 CD270 (HVEM, TR2) 122 Human TGATAGAAACAGACC
TotalSeq™-C 0026 CD47 CC2C6 Human GCATTCTGTCACCTA
TotalSeq™-C 0027 CD70 113-16 Human CGCGAACATAAGAAG
TotalSeq™-C 0028 CD30 BY88 Human TCAGGGTGTGCTGTA
TotalSeq™-C 0029 CD48 BJ40 Human CTACGACGTAGAAGA
TotalSeq™-C 0030 CD277 (BT3.1) BT3.1 Human TACTTCTGGAGCCAG
TotalSeq™-C 0031 CD40 5C3 Human CTCAGATGGAGTATG
TotalSeq™-C 0032 CD154 24-31 Human GCTAGATAGATGCAA
TotalSeq™-C 0033 CD52 HI186 Human CTTTGTACGAGCAAA
TotalSeq™-C 0034 CD3 UCHT1 Human CTCATTGTAACTCCT
TotalSeq™-C 0045 CD4 SK3 Human GAGGTTAGTGATGGA
TotalSeq™-C 0046 CD8 SK1 Human GCGCAACTTGATGAT
TotalSeq™-C 0047 CD56 (NCAM) 5.1H11 Human TCCTTTCCTGATAGG
TotalSeq™-C 0048 CD45 2D1 Human TCCCTTGCGATTTAC
TotalSeq™-C 0049 CD3 SK7 Human TATCCCTTGGGATGG
TotalSeq™-C 0050 CD19 HIB19 Human CTGGGCAATTACTCG
TotalSeq™-C 0051 CD14 63D3 Human CAATCAGACCTATGA
TotalSeq™-C 0052 CD33 P67.6 Human TAACTCAGGGCCTAT
TotalSeq™-C 0053 CD11c S-HCL-3 Human TACGCCTATAACTTG
TotalSeq™-C 0054 CD34 581 Human GCAGAAATCTCCCTT
TotalSeq™-C 0055 CD138 (Syndecan-1) MI15 Human ACTCTTTCGTTTACG
TotalSeq™-C 0056 CD269 (BCMA) 19F2 Human CAGATGATCCACCAT
TotalSeq™-C 0057 β2-microglobulin 2M2 Human CAGCCCGATTAAGGT
TotalSeq™-C 0058 HLA-A,B,C W6/32 Human TATGCGAGGCTTATC
TotalSeq™-C 0060 CD90 (Thy1) 5.00E+10 Human GCATTGTACGATTCA
TotalSeq™-C 0061 CD117 (c-kit) 104D2 Human AGACTAATAGCTGAC
TotalSeq™-C 0062 CD10 HI10a Human CAGCCATTCATTAGG
TotalSeq™-C 0063 CD45RA HI100 Human TCAATCCTTCCGCTT
TotalSeq™-C 0064 CD123 6H6 Human CTTCACTCTGTCAGG
TotalSeq™-C 0066 CD7 CD7-6B7 Human TGGATTCCCGGACTT
TotalSeq™-C 0070 CD49f GoH3 Human.Mouse TTCCGAGGATGATCT
TotalSeq™-C 0071 CD194 (CCR4) L291H4 Human AGCTTACCTGCACGA
TotalSeq™-C 0072 CD4 RPA-T4 Human TGTTCCCGCTCAACT
TotalSeq™-C 0080 CD8a RPA-T8 Human GCTGCGCTTTCCATT
TotalSeq™-C 0081 CD14 M5E2 Human TCTCAGACCTCCGTA
TotalSeq™-C 0083 CD16 3G8 Human AAGTTCACTCTTTGC
TotalSeq™-C 0084 CD56 (NCAM) Recombinant QA17A16 Human TTCGCCGCATTGAGT
TotalSeq™-C 0085 CD25 BC96 Human TTTGTCCTGTACGCC
TotalSeq™-C 0087 CD45RO UCHL1 Human CTCCGAATCATGTTG
TotalSeq™-C 0088 CD279 (PD-1) EH12.2H7 Human ACAGCGCCGTATTTA
TotalSeq™-C 0089 TIGIT (VSTM3) A15153G Human TTGCTTACCGCCAGA
TotalSeq™-C 0090 Mouse IgG1, κ isotype Ctrl MOPC-21 N/A GCCGGACGACATTAA
TotalSeq™-C 0091 Mouse IgG2a, κ isotype Ctrl MOPC-173 N/A CTCCTACCTAAACTG
TotalSeq™-C 0092 Mouse IgG2b, κ isotype Ctrl MPC-11 N/A ATATGTATCACGCGA
TotalSeq™-C 0095 Rat IgG2b, κ Isotype Ctrl RTK4530 N/A GATTCTTGACGACCT
TotalSeq™-C 0100 CD20 2H7 Human TTCTGGGTCCCTAGA
TotalSeq™-C 0101 CD335 (NKp46) 9.00E+02 Human ACAATTTGAACAGCG
TotalSeq™-C 0102 CD294 (CRTH2) BM16 Human TGTTTACGAGAGCCC
TotalSeq™-C 0123 CD326 (Ep-CAM) 9C4 Human TTCCGAGCAAGTATC
TotalSeq™-C 0124 CD31 WM59 Human ACCTTTATGCCACGG
TotalSeq™-C 0125 CD44 BJ18 Human AATCCTTCCGAATGT
TotalSeq™-C 0127 Podoplanin NC-08 Human GGTTACTCGTTGTGT
TotalSeq™-C 0134 CD146 P1H12 Human CCTTGGATAACATCA
TotalSeq™-C 0136 IgM MHM-88 Human TAGCGAGCCCGTATA
TotalSeq™-C 0138 CD5 UCHT2 Human CATTAACGGGATGCC
TotalSeq™-C 0140 CD183 (CXCR3) G025H7 Human GCGATGGTAGATTAT
TotalSeq™-C 0141 CD195 (CCR5) J418F1 Human CCAAAGTAAGAGCCA
TotalSeq™-C 0142 CD32 FUN-2 Human GCTTCCGAATTACCG
TotalSeq™-C 0143 CD196 (CCR6) G034E3 Human GATCCCTTTGTCACT
TotalSeq™-C 0144 CD185 (CXCR5) J252D4 Human AATTCAACCGTCGCC
TotalSeq™-C 0145 CD103 (Integrin αE) Ber-ACT8 Human GACCTCATTGTGAAT
TotalSeq™-C 0146 CD69 FN50 Human GTCTCTTGGCTTAAA
TotalSeq™-C 0147 CD62L DREG-56 Human GTCCCTGCAACTTGA
TotalSeq™-C 0148 CD197 (CCR7) G043H7 Human AGTTCAGTCAACCGA
TotalSeq™-C 0149 CD161 HP-3G10 Human GTACGCAGTCCTTCT
TotalSeq™-C 0151 CD152 (CTLA-4) BNI3 Human ATGGTTCACGTAATC
TotalSeq™-C 0152 CD223 (LAG-3) 11C3C65 Human CATTTGTCTGCCGGT
TotalSeq™-C 0153 KLRG1 (MAFA) SA231A2 Human CTTATTTCCTGCCCT
TotalSeq™-C 0154 CD27 O323 Human GCACTCCTGCATGTA
TotalSeq™-C 0155 CD107a (LAMP-1) H4A3 Human CAGCCCACTGCAATA
TotalSeq™-C 0156 CD95 (Fas) DX2 Human CCAGCTCATTAGAGC
TotalSeq™-C 0158 CD134 (OX40) Ber-ACT35 (ACT35) Human AACCCACCGTTGTTA
TotalSeq™-C 0159 HLA-DR L243 Human AATAGCGAGCAAGTA
TotalSeq™-C 0160 CD1c L161 Human GAGCTACTTCACTCG
TotalSeq™-C 0161 CD11b ICRF44 Human GACAAGTGATCTGCA
TotalSeq™-C 0162 CD64 10.1 Human AAGTATGCCCTACGA
TotalSeq™-C 0163 CD141 (Thrombomodulin) M80 Human GGATAACCGCGCTTT
TotalSeq™-C 0164 CD1d 51.1 Human TCGAGTCGCTTATCA
TotalSeq™-C 0165 CD314 (NKG2D) 1D11 Human CGTGTTTGTTCCTCA
TotalSeq™-C 0166 CD66b 6/40c Human AGCTGTAAGTTTCGG
TotalSeq™-C 0167 CD35 E11 Human ACTTCCGTCGATCTT
TotalSeq™-C 0168 CD57 Recombinant QA17A04 Human AACTCCCTATGGAGG
TotalSeq™-C 0169 CD366 (Tim-3) F38-2E2 Human TGTCCTACCCAACTT
TotalSeq™-C 0170 CD272 (BTLA) MIH26 Human GTTATTGGACTAAGG
TotalSeq™-C 0171 CD278 (ICOS) C398.4A Human, Mouse, Rat CGCGCACCCATTAAA
TotalSeq™-C 0174 CD58 (LFA-3) TS2/9 Human GTTCCTATGGACGAC
TotalSeq™-C 0175 CD96 (TACTILE) NK92.39 Human TGGCCTATAAATGGT
TotalSeq™-C 0176 CD39 A1 Human TTACCTGGTATCCGT
TotalSeq™-C 0177 CD178 (Fas-L) NOK-1 Human CCGGTCCTCTGTATT
TotalSeq™-C 0179 CX3CR1 K0124E1 Human AGTATCGTCTCTGGG
TotalSeq™-C 0180 CD24 ML5 Human AGATTCCTTCGTGTT
TotalSeq™-C 0181 CD21 Bu32 Human AACCTAGTAGTTCGG
TotalSeq™-C 0185 CD11a TS2/4 Human TATATCCTTGTGAGC
TotalSeq™-C 0187 CD79b (Igβ) CB3-1 Human ATTCTTCAACCGAAG
TotalSeq™-C 0188 CD66a/c/e ASL-32 Human GGGACAGTTCGTTTC
TotalSeq™-C 0189 CD244 (2B4) C1.7 Human TCGCTTGGATGGTAG
TotalSeq™-C 0196 CD235ab HIR2 Human GCTCCTTTACACGTA
TotalSeq™-C 0214 integrin β7 FIB504 Human, Mouse TCCTTGGATGTACCG
TotalSeq™-C 0217 CD54 HA58 Human CTGATAGACTTGAGT
TotalSeq™-C 0224 TCR α/β IP26 Human CGTAACGTAGAGCGA
TotalSeq™-C 0250 KLRG1 (MAFA) 2F1/KLRG1 Human, Mouse GTAGTAGGCTAGACC
TotalSeq™-C 0352 FcεRIα AER-37 (CRA-1) Human CTCGTTTCCGTATCG
TotalSeq™-C 0355 CD137 (4-1BB) 4B4-1 Human CAGTAAGTTCGGGAC
TotalSeq™-C 0356 CD254 (TRANCE, RANKL) MIH24 Human TCCGTGTTAGTTTGT
TotalSeq™-C 0359 CD83 HB15e Human CCACTCATTTCCGGT
TotalSeq™-C 0360 CD357 (GITR) 108-17 Human ACCTTTCGACACTCG
TotalSeq™-C 0363 CD124 (IL-4Rα) G077F6 Human CCGTCCTGATAGATG
TotalSeq™-C 0364 CD13 WM15 Human TTTCAACGCCCTTTC
TotalSeq™-C 0366 CD184 (CXCR4) 12G5 Human TCAGGTCCTTTCAAC
TotalSeq™-C 0367 CD2 TS1/8 Human TACGATTTGTCAGGG
TotalSeq™-C 0368 CD226 (DNAM-1) 11A8 Human TCTCAGTGTTTGTGG
TotalSeq™-C 0369 CD29 TS2/16 Human GTATTCCCTCAGTCA
TotalSeq™-C 0371 CD49b P1E6-C5 Human GCTTTCTTCAGTATG
TotalSeq™-C 0373 CD81 (TAPA-1) 5A6 Human GTATCCTTCCTTGGC
TotalSeq™-C 0374 CD98 MEM-108 Human GCACCAACAGCCATT
TotalSeq™-C 0375 IgG Fc M1310G05 Human CTGGAGCGATTAGAA
TotalSeq™-C 0384 IgD IA6-2 Human CAGTCTCCGTAGAGT
TotalSeq™-C 0385 CD18 TS1/18 Human TATTGGGACACTTCT
TotalSeq™-C 0386 CD28 CD28.2 Human TGAGAACGACCCTAA
TotalSeq™-C 0387 TSLPR (TSLP-R) 1D3 Human CAGTCCTCTCTGTCA
TotalSeq™-C 0389 CD38 HIT2 Human TGTACCCGCTTGTGA
TotalSeq™-C 0390 CD127 (IL-7Rα) A019D5 Human GTGTGTTGTCCTATG
TotalSeq™-C 0391 CD45 HI30 Human TGCAATTACCCGGAT
TotalSeq™-C 0392 CD15 (SSEA-1) W6D3 Human TCACCAGTACCTAGT
TotalSeq™-C 0393 CD22 S-HCL-1 Human GGGTTGTTGTCTTTG
TotalSeq™-C 0394 CD71 CY1G4 Human CCGTGTTCCTCATTA
TotalSeq™-C 0395 B7-H4 MIH43 Human TGTATGTCTGCCTTG
TotalSeq™-C 0396 CD26 BA5b Human GGTGGCTAGATAATG
TotalSeq™-C 0407 CD36 5-271 Human TTCTTTGCCTTGCCA
TotalSeq™-C 0577 CD73 (Ecto-5'-nucleotidase) AD2 Human CAGTTCCTCAGTTCG
TotalSeq™-C 0582 TCR Vδ2 B6 Human TCAGTCAGATGGTAT
TotalSeq™-C 0594 CD133 S16016B Human GTAAGACGCCTATGC
TotalSeq™-C 0801 CD337 (NKp30) P30-15 Human AAAGTCACTCTGCCG
TotalSeq™-C 0802 CD336 (NKp44) P44-8 Human GGGCAATTAGCGAGT

 

Jump to Top

No Results Found. Please try a different search term.

Conjugation of antibodies to oligonucleotides has many applications, from their potential utility as adjuvants or targeted drug delivery systems, to the recently published simultaneous protein and RNA quantification in single cells, these reagents are opening new avenues to enable researchers move forward the frontiers of science.


A recent publication by Stoeckius et al. used antibodies coupled with oligonucleotides to simultaneously measure proteins and RNA at a single cell level. The method, termed cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq), combines highly multiplexed protein marker detection with unbiased transcriptome profiling for thousands of single cells. The authors also report that the method is compatible with two high-throughput scRNA-seq platforms, Drop-seq and 10X Genomics. A similar approach was used by Peterson et al., they termed their workflow RNA expression and protein sequencing assay (REAP-seq).

Originally, Stoeckius et al. used antibodies conjugated to streptavidin and biotinylated oligonucleotides to link the antibody and the oligonucleotide together. BioLegend is now offering antibodies directly conjugated to oligonucleotides, under our brand name TotalSeq™, to help accelerate single cell genomics and other applications.


BioLegend’s revolutionary TotalSeq™ product suite integrates seamlessly with these workflows, and enables highly multiplexed proteomics and proteogenomics across a range of next generation sequencing applications, from bulk sample analysis to highly parallel single cell sequencing. Read the press releases announcing BioLegend and New York Genome Center® exclusive global license and research agreement, as well as our collaboration with 10x Genomics. To view the list of already assigned barcodes, please click in the Barcodes tab. To request a custom conjugated antibody, please fill in the Custom Order Form.

 

  1. Stain with TotalSeq™ reagents
  2. Run single cell platform, with Antibody- Derived Tags (ADT, antibody-oligo conjugates) amplification
  3. Separate ADT-derived cDNA from mRNA-derived cDNA
  4. Amplify both cDNA libraries
  5. Sequence libraries

 

Fig 1. Diagram illustrating CITE-seq workflow. Step 2 can be performed by Drop-seq (depicted in the figure), or another compatible method such as 10X Genomics platform.

 

 

Fig 2. Clustering of approximately 5,000 CITE-seq single-cell expression profiles of PBMCs reveals distinct cell populations based on transcriptome analysis. The left panel shows a two-dimensional representation (tSNE) of global gene expression relationships among all cells. Major cell types in peripheral blood can be discerned based on marker gene expression as indicated. The right panels show mRNA (blue) and corresponding Antibody-Derived Tag (ADT, green) signal for the CITE-seq antibody panel projected on the tSNE plot. Darker shading corresponds to higher levels measured.

In addition to our collection of antibody oligonucleotide conjugates for protein quantification, we are also refining the process of identifying each cell with its sample origin, as well as data generated from doublets instead of single cells when mixing multiple samples. The method is powered by our cell hashtag reagents. Please read Stoeckius M. et al. for more information about cell hashing.

 

The hashtags are designed so that they are specific for human or mouse cells, and to cover as many cells as possible. For human samples the hashtags are made of two antibodies that recognize ubiquitous surface markers, CD298 and β2 microglobulin, each conjugated to the same oligonucleotide containing the barcode sequence. For mouse samples, the surface markers are CD45 and H-2 MHC class I. The conjugates are already pre-mixed and ready to use.

 

For TotalSeq™-A reagents, the PCR handle between regular antibodies and the hashtag versions is different. In practice, this means that two different libraries can be prepared, one for the regular antibodies (commonly referred as ADT), and one for the hashtags (commonly referred to as HTO). They can then be mixed at different ratios before sequencing, to avoid an excess of HTO readings.

 

For TotalSeq™-C reagents, the PCR handle and capture sequence between regular antibodies and the hashtag versions is the same. In practice, this means that preparation of two different libraries is no longer possible. Thus, the most efficient way to avoid an excess of HTO readings is to titrate the Hashtag reagents. There are several ways to titrate TotalSeq™ reagents. Please read the FAQs for more information.

The tables below contains barcodes for products available to purchase, as well as conjugates that will released in the future.

 

Click on the links below to jump to a table.

TotalSeq™-A

TotalSeq™-C

TotalSeq™-A

Download as Excel document:
Category Barcode Specificity Reactivity Barcode sequence
TotalSeq™-A 0251 anti-human Hashtag 1 Human GTCAACTCTTTAGCG
TotalSeq™-A 0252 anti-human Hashtag 2 Human TGATGGCCTATTGGG
TotalSeq™-A 0253 anti-human Hashtag 3 Human TTCCGCCTCTCTTTG
TotalSeq™-A 0254 anti-human Hashtag 4 Human AGTAAGTTCAGCGTA
TotalSeq™-A 0255 anti-human Hashtag 5 Human AAGTATCGTTTCGCA
TotalSeq™-A 0256 anti-human Hashtag 6 Human GGTTGCCAGATGTCA
TotalSeq™-A 0257 anti-human Hashtag 7 Human TGTCTTTCCTGCCAG
TotalSeq™-A 0258 anti-human Hashtag 8 Human CTCCTCTGCAATTAC
TotalSeq™-A 0259 anti-human Hashtag 9 Human CAGTAGTCACGGTCA
TotalSeq™-A 0260 anti-human Hashtag 10 Human ATTGACCCGCGTTAG
TotalSeq™-A 0262 anti-human Hashtag 12 Human TAACGACCAGCCATA
TotalSeq™-A 0263 anti-human Hashtag 13 Human AAATCTCTCAGGCTC
TotalSeq™-A 0264 anti-human Hashtag 14 Human CTGTATGTCCGATTG
TotalSeq™-A 0265 anti-human Hashtag 15 Human TAAGATTCAGAGCGA
TotalSeq™-A 0266 anti-Biotin Hashtag 1 Biotin GGTAGTCATCGTGGT
TotalSeq™-A 0267 anti-Biotin Hashtag 2 Biotin GTCCGTATTCTGTCA
TotalSeq™-A 0268 anti-Biotin Hashtag 3 Biotin TCCCTTTATGCGAGG
TotalSeq™-A 0269 anti-Biotin Hashtag 4 Biotin AAAGCATGACCAGTA
TotalSeq™-A 0270 anti-Biotin Hashtag 5 Biotin TACAGTCGCTTGGCA
TotalSeq™-A 0271 anti-Biotin Hashtag 6 Biotin CTCTCCCTTTGTAGT
TotalSeq™-A 0272 anti-Biotin Hashtag 7 Biotin GGGCTTATCATTAAG
TotalSeq™-A 0274 anti-Biotin Hashtag 9 Biotin TGGAGTATCACCAAT
TotalSeq™-A 0275 anti-Biotin Hashtag 10 Biotin AAGAACGACCTCCTT
TotalSeq™-A 0301 anti-mouse Hashtag 1 Mouse ACCCACCAGTAAGAC
TotalSeq™-A 0302 anti-mouse Hashtag 2 Mouse GGTCGAGAGCATTCA
TotalSeq™-A 0303 anti-mouse Hashtag 3 Mouse CTTGCCGCATGTCAT
TotalSeq™-A 0304 anti-mouse Hashtag 4 Mouse AAAGCATTCTTCACG
TotalSeq™-A 0305 anti-mouse Hashtag 5 Mouse CTTTGTCTTTGTGAG
TotalSeq™-A 0306 anti-mouse Hashtag 6 Mouse TATGCTGCCACGGTA
TotalSeq™-A 0307 anti-mouse Hashtag 7 Mouse GAGTCTGCCAGTATC
TotalSeq™-A 0308 anti-mouse Hashtag 8 Mouse TATAGAACGCCAGGC
TotalSeq™-A 0309 anti-mouse Hashtag 9 Mouse TGCCTATGAAACAAG
TotalSeq™-A 0310 anti-mouse Hashtag 10 Mouse CCGATTGTAACAGAC
TotalSeq™-A 0311 anti-mouse Hashtag 11 Mouse GCTTACCGAATTAAC
TotalSeq™-A 0312 anti-mouse Hashtag 12 Mouse CTGCAAATATAACGG
TotalSeq™-A 0313 anti-mouse Hashtag 13 Mouse CTACATTGCGATTTG
TotalSeq™-A 0314 anti-mouse Hashtag 14 Mouse CTTTCGCCAACTCTG
TotalSeq™-A 0315 anti-mouse Hashtag 15 Mouse CCCTCTCTGGATTCT

No Results Found. Please try a different search term.

TotalSeq™-C

Download as Excel document:
Category Barcode Specificity Reactivity Barcode sequence
TotalSeq™-C 0251 anti-human Hashtag 1 Human GTCAACTCTTTAGCG
TotalSeq™-C 0252 anti-human Hashtag 2 Human TGATGGCCTATTGGG
TotalSeq™-C 0253 anti-human Hashtag 3 Human TTCCGCCTCTCTTTG
TotalSeq™-C 0254 anti-human Hashtag 4 Human AGTAAGTTCAGCGTA
TotalSeq™-C 0255 anti-human Hashtag 5 Human AAGTATCGTTTCGCA
TotalSeq™-C 0301 anti-mouse Hashtag 1 Mouse ACCCACCAGTAAGAC
TotalSeq™-C 0302 anti-mouse Hashtag 2 Mouse GGTCGAGAGCATTCA
TotalSeq™-C 0303 anti-mouse Hashtag 3 Mouse CTTGCCGCATGTCAT
TotalSeq™-C 0304 anti-mouse Hashtag 4 Mouse AAAGCATTCTTCACG
TotalSeq™-C 0305 anti-mouse Hashtag 5 Mouse CTTTGTCTTTGTGAG

No Results Found. Please try a different search term.

We are glad to see that you are just as excited as we are to launch this new product line. As we build our portfolio of oligo conjugated antibodies we are collecting information regarding clone and target preferences so we can prioritize our pipeline. Please use this form to tell us about your oligo-antibody project. A BioLegend representative will contact you to discuss your request.
 

Your personal data will be handled according to our Privacy Policy. By submitting this request, you consent to being contacted by BioLegend so we may share the latest updates about products, services, promotions, and events. In addition, if you are located within a Distributor Territory, you may be contacted directly by them. We never sell your data to anyone. To view, edit or delete your preferences or personal information, please fill out our Privacy Request Form.

Login / Register
Forgot your password? Reset password?
Create an Account