TotalSeq™-D0064 anti-human CD123 Antibody

Pricing & Availability
6H6 (See other available formats)
Regulatory Status
Other Names
IL-3Rα, IL-3 Receptor alpha
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Avail. Save
306051 10 µg £222
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD123 is the 70 kD transmembrane α chain of the IL-3 receptor. Alone, CD123 binds IL-3 with low affinity; when CD123 associates with CDw131 (common β chain), it binds IL-3 with high affinity. CD123 does not transduce intracellular signals upon binding IL-3 and requires the β chain for this function. CD123 is expressed by myeloid precursors, macrophages, dendritic cells, mast cells, basophils, megakaryocytes, and some B cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Human, Cross-Reactivity: Rhesus
Antibody Type
Host Species
Human IL-3Rα transfected COS cells.
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 6H6 does not inhibit IL-3 binding to low- or high-affinity IL-3Rs. Additional reported applications (for the relevant formats) include: Western blotting1, immunoprecipitation1, and immunohistochemical staining of acetone-fixed frozen sectionsand also paraformaldehyde fixed paraffin embedded tissue7.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Sun Q, et al. 1996. Blood 87:83. (IP, WB)
  2. Herling M, et al. 2003. Blood 101:5007. (IHC)
  3. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  4. Martin-Gayo E, et al. 2010. Blood 115:5366. PubMed
  5. Chen SC, et al. 2010. Arch Dermatol Res. 302:113. PubMed
  6. Liu Y, et al. 2012. Food Chem Toxicol. 50:1920. PubMed
  7. Peduzzi E, et al. 2007. J. Invest. Dermatol. 127:638. (IHC)

Antigen Details

Ig superfamily, type I transmembrane glycoprotein, associates with CDw131, 70 kD

Myeloid precursors, basophils, mast cells, macrophages, dendritic cells, megakaryocytes, subset of lymphocytes

Hematopoietic cell proliferation, differentiation
Cell Type
Basophils, Dendritic cells, Hematopoietic stem and progenitors, Lymphocytes, Macrophages, Mast cells, Megakaryocytes
Biology Area
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Miyajima A, et al. 1993. Blood 82:1960.

Gene ID
3563 View all products for this Gene ID
View information about CD123 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Insert Note Here
Save Close Clear
Lab Timer
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account