TotalSeq™-D0060 anti-human CD90 (Thy1) Antibody

Pricing & Availability
Clone
5E10 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
Thy-1, Thy1
Isotype
Mouse IgG1, κ
Barcode Sequence
GCATTGTACGATTCA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
328149 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD90 is a 25-35 kD GPI-anchored protein, also known as Thy-1. It belongs to the Ig superfamily. Human CD90 is expressed on neuronal cells, a subset of CD34+ cells, a subset of fetal liver cells and fetal thymocytes, fibroblasts, activated endothelial cells, and some leukemia cell lines. CD34+CD90+ cells are primitive hematopoietic stem cells. It has been reported that Thy-1 binds with β2 and β3 integrins and plays bimodal roles in the regulation of cell adhesion and neurite outgrowth, and inhibits hematopoietic stem cells proliferation and differentiation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Pigtailed Macaque, Rhesus, Pig
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
HEL cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 5E10 recognizes an epitope on Thy-1 independent of its glycosylation, but is abolished under reducing conditions.4 Additional reported (for the relevant formats) applications include: immunohistochemical staining of acetone-fixed frozen sections, immunoprecipitation1, and immunofluorescence3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Craig W, et al. 1993. J. Exp. Med. 177:1331. (IP)
  2. Gundlach CW 4th, et al. 2011. Bioconjug. Chem. 22:1706. (Pig Reactivity)
  3. Touboul C, et al. 2013. J. Transl. Med. 11:28. (IF)
  4. Bradley JE, et al. 2013. Lab Invest. 93:365. (Epitope)
  5. Donnenberg VS, et al. 2010. Cytometry B. Clin. Cytom. 5:287. (IHC)
RRID
AB_2904348 (BioLegend Cat. No. 328149)

Antigen Details

Structure
25-35 kD glycoprotein, Ig superfamily
Distribution

Subset of CD34+ hematopoietic stem cells, subset of fetal thymocytes, subset of fetal liver cells, fibroblast, activated endothelial cells, neurons and some leukemia cell lines

Function
Regulate hematopoiesis and neural cell growth, cell adhesion
Ligand/Receptor
β3 integrin, β2 integrin
Cell Type
Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors, Leukemia, Mesenchymal Stem Cells, Neurons, Thymocytes
Biology Area
Immunology, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. McKenzie JL, et al. 1981. J. Immunol. 126:843.
2. Avalos AM, et al. 2002. Biol. Res. 35:231.
3. Wetzel A, et al. 2004. J. Immunol. 172:3850.

Gene ID
7070 View all products for this Gene ID
UniProt
View information about CD90 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/05/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • PE/Cyanine7 anti-human CD90 (Thy1)

  • Purified anti-human CD90 (Thy1)

  • Biotin anti-human CD90 (Thy1)

  • FITC anti-human CD90 (Thy1)

  • PE anti-human CD90 (Thy1)

  • PE/Cyanine5 anti-human CD90 (Thy1)

  • APC anti-human CD90 (Thy1)

  • Alexa Fluor® 647 anti-human CD90 (Thy1)

  • PerCP/Cyanine5.5 anti-human CD90 (Thy1)

  • Alexa Fluor® 700 anti-human CD90 (Thy1)

  • Brilliant Violet 421™ anti-human CD90 (Thy1)

  • Brilliant Violet 510™ anti-human CD90 (Thy1)

  • Brilliant Violet 605™ anti-human CD90 (Thy1)

  • Purified anti-human CD90 (Thy1) (Maxpar® Ready)

  • APC/Cyanine7 anti-human CD90 (Thy1)

  • PE/Dazzle™ 594 anti-human CD90 (Thy1)

  • APC/Fire™ 750 anti-human CD90 (Thy1)

  • Brilliant Violet 711™ anti-human CD90 (Thy1)

  • TotalSeq™-A0060 anti-human CD90 (Thy1)

  • Brilliant Violet 785™ anti-human CD90 (Thy1)

  • Brilliant Violet 650™ anti-human CD90 (Thy1)

  • TotalSeq™-C0060 anti-human CD90 (Thy1)

  • TotalSeq™-B0060 anti-human CD90 (Thy1)

  • TotalSeq™-D0060 anti-human CD90 (Thy1)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account