TotalSeq™-A0573 anti-mouse CD140a Antibody

Pricing & Availability
Clone
APA5 (See other available formats)
Other Names
PDGF receptor-α, PDGFR-α
Isotype
Rat IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
135917 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Platelet-derived growth factor receptor-α (PDGFR-α), CD140a, is one of two receptors for platelet-derived growth factors (PDGFs) and binds to all isoforms of PDGFs: PDGF-AA, PDGF-AB, and PDGF-BB. PDGFRa is a receptor tyrosine kinase that forms homodimers or heterodimers on the surface upon ligand binding and phosphorylates substrates. PDGFRs consist of either homodimers of α/α, β/β, or heterodimers of α/β. PDGF receptors, α and β, are single glycoproteins with intracellular tyrosine kinase domain. Their ligand, PDGF, is a mitogen for connective tissue and glial cells. CD140a is expressed on embryonic tissues and mesenchymal-derived cells of adult mice. PDGF plays a role in wound healing and acts as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes, and neutrophils.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse PDGFR-α-hIgG1 recombinant fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for relevant formats) applications include: Western Blot, blocking function2, and immunohistochemical staining of paraffin and frozen sections. The LEAF™ purified antibody is recommended for functional assays.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone APA5 is GTCATTGCGGTCCTA.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA[GTCATTGCGGTCCTA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Takakura N, et al. 1996. J. Invest. Dermatol. 107:770.
  2. Liao C, et al. 2010. J. Clin. Invest. 120:242. (Block)
  3. Chen H, et al. 2015. ASN Neuro 8:7. PubMed
RRID
AB_2783094 (BioLegend Cat. No. 135917)

Antigen Details

Structure
Alpha chain of the platelet-derived growth factor receptor, a receptor tyrosine kinase that forms homo- or hetero-dimers on the surface after ligand binding.
Distribution

Expressed on embryonic tissues and mesenchymal-derived cells of adult mouse.

Function
Play a role in wound healing and act as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes and neutrophils.
Ligand Receptor
PDGFs
Cell Type
Mesenchymal cells, Mesenchymal Stem Cells, Embryonic Stem Cells
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Mukouyama YS, et al. 2006. Proc Natl Acad Sci USA. 103(5):1551
2. Miyawaki T, et al. 2004. J Neurosci. 24(37):8124
3. Takakura N, et al. 1997. J Histochem Cytochem. 45(6):883

Gene ID
18595 View all products for this Gene ID
UniProt
View information about CD140a on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/28/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account