TotalSeq™-A0566 anti-mouse CD301b (MGL2) Antibody

Pricing & Availability
Clone
URA-1 (See other available formats)
Other Names
MGL, M-ASGP-BP, Macrophage galactose-type C-type lectin
Isotype
Rat IgG2a, λ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
146817 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Mouse CD301, also known as macrophage galactose-type C-type lectin, has two homologue genes, CD301a (MGL1) and CD301b (MGL2), while there is only one MGL in human and rat.  Mouse CD301a and CD301b are ~42 kD type II transmembrane glycoproteins containing a cytoplasmic domain, a transmembrane domain, a neck domain, and a carbohydrate recognition domain (CRD) within each molecule. CD301a is mainly expressed on a subset of macrophages and immature dendritic cells (DCs). CD301b is mainly found on conventional DCs. Although CD301a and CD301b share high amino acid sequence homology (92% for the intact sequence and 80% for the CRD), they display different carbohydrate specificities. CD301a was found to be highly specific for Lewis X and Lewis A structures, whereas CD301b, more similar to human MGL, recognizes N-actetylgalactosamine (GalNAc) and galactose, including the O-linked Tn-antigen, TF-antigen, and core 2.  So far, CD301a has been reported to be involved in recognition and  endocytosis of glycoproteins with terminal Gal/GalNAc moieties. This contributes to defense against tumor cell metastasis, tissue remodeling, and clearance of apoptotic cells in embryos. CD301b is involved in the internalization of soluble polyacrylamide polymers (PAA) with α-GalNAc residues (GalNAc-PAA) in bone marrow derived DCs.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Purified and recombinant mouse MGL2
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone URA-1 is CTTGCCTTGCGATTT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CTTGCCTTGCGATTT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

RRID
AB_2783115 (BioLegend Cat. No. 146817)

Antigen Details

Structure
42 kD type II transmembrane glycoproteins, contains a cytoplasmic domain, a transmembrane domain, a neck domain, and a carbohydrate recognition domain (CRD) within each molecule
Distribution

Dermal dendritic cells

Function
Cell adhesion, cell-cell signaling, glycoprotein turnover, inflammation, tissue remodeling
Interaction
Carbohydrate determinants, GP envelope glycoprotein on Marburg and Ebola viruses
Cell Type
Dendritic cells
Biology Area
Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Denda-Nagai K, et al. 2010. J. Biol. Chem. 285:19193.
2. Westcott D, et al. 2009. J. Exp. Med. 206:3143.
3. Singh SK, et al. 2009. Mol. Immunol. 46:1240.
4. Sakakura M, et al. 2008. J. Biol. Chem. 283:33665.
5. Tsuiji M, et al. 2002. J. Biol. Chem. 277:28892.

Gene ID
216864 View all products for this Gene ID
UniProt
View information about CD301b on UniProt.org

Related FAQs

Can I an isotype control with a lambda light chain be substituted with an isotype control with a kappa light chain for flow cytometry?

Yes, you can since kappa and lambda represent light chains which don't contribute to the background staining.

Go To Top Version: 1    Revision Date: 12/17/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account