TotalSeq™-A0398 anti-human CD115 (CSF-1R) Antibody

Pricing & Availability
Clone
9-4D2-1E4 (See other available formats)
Workshop
V MA199
Other Names
M-CSFR,CSF-1R, FMS, CSF-1 Receptor
Isotype
Rat IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
347325 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CSF-1R, also known as CD115 and M-CSFR, is a single-pass type I membrane protein and member of the platelet-derived growth factor receptor family. Structural studies of CD115 have described an Ig-like extracellular domain, a transmembrane domain, an intracellular juxtamembrane domain, a split tyrosine kinase domain, and a C-terminal tail receptor. Receptor activation induces homodimerization in addition to phosphorylation and ubiquitinylation of intracellular residues. The natural ligands of CD115 include M-CSF and IL-34. CD115 directly influences tissue macrophage and osteoclast differentiation and proliferation. It is expressed on monocytes/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
C-fms transduced Kirsten strain murine sarcoma virus transformed NRK cells.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature.  Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation. Pre-treatment with EDTA and low temperatures (2 to 8°C) helps in maintaining surface expression of CD1151.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. a scRNAseq device) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone 9-4D2-1E4 is AATCACGGTCCTTGT.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA[AATCACGGTCCTTGT] BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Breslin WL, et al. 2013. J Immunol Methods. 390(1-2):1 PubMed
RRID
AB_2783237 (BioLegend Cat. No. 347325)

Antigen Details

Structure
Single-pass type I membrane protein and is 150 kD.
Distribution

Monocytes/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.

Ligand Receptor
Macrophage Colony Stimulating Factor (M-CSF) and IL-34.
Cell Type
Dendritic cells
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Sherr CJ, et al. 1989. Blood 73:1786
2. Roussel MF, et al. 1991. Nature 353:361.
3. Roussel MF, et al. 1989 P. Natl. Acad. Sci. USA 86:7924.

Gene ID
1436 View all products for this Gene ID
UniProt
View information about CD115 on UniProt.org

Related FAQs

Why do I have a weak CD115 staining?

It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation.  Pre-treatment with EDTA and low temperatures (2 - 8°C) helps in maintaining surface expression of CD115. In addition, brief fixation of the cells with Fixation Buffer (Cat. No. 420801) for 10 minutes will block CD115 internalization.

Go To Top Version: 1    Revision Date: 10/05/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account