TotalSeq™-A0213 anti-human Notch 1 Antibody

Pricing & Availability
Clone
MHN1-519 (See other available formats)
Other Names
Neurogenic locus notch homolog protein 1 (Notch 1), Translocation-associated notch protein (TAN-1), Motch A, mT14, p300
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
352109 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Notch 1, also known as TAN-1, is a transmembrane protein. Its extracellular domain contains 29 epidermal growth factor-like (EGF) repeats and 3 Lin/Notch Glp (LNR) repeats, the intracellular domain contains 5 CDC10/Ankryn repeats (ANK), 1 proline, glutamate, serine, threonine-rich (PEST) motif, and 1 regulation of amino acid metabolism 23 (RAM23) domain. Notch 1 regulates the development, differentiation, and survival of a broad spectrum of cell lineages. It is involved in  myogenesis, neurogenesis, gliogenesis, and lymphocyte development, resulting in Notch 1 expression in many organs such as brain, lung, thymus, spleen, bone marrow, spinal cord, eyes, mammary gland, liver, intestine, kidney, and heart. Notch 1 ligands are Jagged 1, Jagged 2, Delta 1, and Delta 4. Upon ligand binding, the intracellular domain of Notch 1 is cleaved and translocates to the cell nucleus where it forms a transcriptional activator complex with RBP-J κ.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human Notch1-Fc fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking Notch 1 mediated binding to DLL4 in human cord blood CD34+ cells1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone MHN1-519 is AATCTGTAGTGCGTT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [AATCTGTAGTGCGTT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Haraguchi K, et al. 2009. J. Immunol. 182:6168. (Block)
  2. Yamanda S, et al. 2009. Blood 113:3631. (FC)
  3. Guy CS. et al. 2013. Nat Immunol. 14:262. PubMed
RRID
AB_2783247 (BioLegend Cat. No. 352109)

Antigen Details

Structure
Transmembrane protein. The extracellular domain contains 29 EGF repeats and 3 LNR repeats. The intracellular domain contains 5 CDC10/ANK, 1 PEST motif, and 1 RAM23 domain.
Distribution

Highly expressed in the brain, lung, and thymus. Lower levels of expression in spleen, bone marrow, spinal cord, eyes, mammary gland, liver, intestine, kidney, and heart.

Function
Regulates development, differentiation, and survival of a broad spectrum of cell lineages. Involved in myogenesis, neurogenesis, gliogenesis, and lymphocyte development.
Interaction
RBP-J κ.
Ligand Receptor
Jagged 1, Jagged 2, Delta 1, Delta 4.
Cell Type
Thymocytes, B cells, Neural Stem Cells
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers, Stem Cells, Synaptic Biology
Molecular Family
Postsynaptic proteins
Antigen References

1. Vicente R, et al. 2010. Semin. Immunol. 22:270.
2. Zhao WL. 2010. Leukemia 24:13.
3. Sanda T, et al. 2010. Blood 115:1735.
4. Zhou J, et al. 2009. Immunity 31:356.

Gene ID
4851 View all products for this Gene ID
UniProt
View information about Notch 1 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 12/05/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account