TotalSeq™-D0360 anti-human CD357 (GITR) Antibody

Pricing & Availability
108-17 (See other available formats)
Regulatory Status
Other Names
TNFRSF18, Activation-inducible TNFR, AITR, Glucocorticoid-inducible TNFR
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
371233 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

GITR (glucocorticoid-induced TNF receptor family-regulated gene) is a 25 kD TNF receptor superfamily member (also known as AITR and TNFRSF18). GITR is expressed on activated lymphocytes and is upregulated by T cell receptor engagement. The cytoplasmic domain of GITR is homologous to CD40, 4-1BB and CD27 and has been shown to interact with TRAF 1-3, but not TRAF 5 or 6. GITR signaling has been shown to regulate T cell proliferation and TCR-mediated apoptosis, and to break immunological self-tolerance. GITR binds GITRL and is involved in the development of regulatory T cells and to regulate the activity of Th1 subsets.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Antibody Type
Host Species
Recombinant human GITR-Fc chimera
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

AB_2894619 (BioLegend Cat. No. 371233)

Antigen Details

TNFR superfamily, 234-amino acid type I transmembrane protein, 25 kD.

Activated lymphocytes.

Interacts with TRAF's 1-3, but not TRAF 5 or 6, mediates NF-κB activation through the TRAF2/NIK pathway.
Cell Type
Lymphocytes, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. van der Werf N, et al. 2011. J. Immunol. 187:1411.
2. Shimizu J, et al. 2002. Nat. Immunol. 3:135.
3. McHugh RS, et al. 2002. Immunity 16:311.
4. Kwon B, et al. 1999. J. Biol. Chem. 274:6056.

Gene ID
8784 View all products for this Gene ID
View information about CD357 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.26.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD357 (GITR)

  • Brilliant Violet 421™ anti-human CD357 (GITR)

  • PE anti-human CD357 (GITR)

  • APC anti-human CD357 (GITR)

  • Alexa Fluor® 488 anti-human CD357 (GITR)

  • Brilliant Violet 605™ anti-human CD357 (GITR)

  • PerCP/Cyanine5.5 anti-human CD357 (GITR)

  • PE/Cyanine7 anti-human CD357 (GITR)

  • Biotin anti-human CD357 (GITR)

  • Brilliant Violet 711™ anti-human CD357 (GITR)

  • APC/Fire™ 750 anti-human CD357 (GITR)

  • Alexa Fluor® 647 anti-human CD357 (GITR)

  • TotalSeq™-A0360 anti-human CD357 (GITR)

  • TotalSeq™-C0360 anti-human CD357 (GITR)

  • Brilliant Violet 750™ anti-human CD357 (GITR)

  • TotalSeq™-B0360 anti-human CD357 (GITR)

  • TotalSeq™-D0360 anti-human CD357 (GITR)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account