- Clone
- 113-16 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD27 ligand, CD27L, Ki-24 antigen, Tumor necrosis factor ligand superfamily, member 7 (TNFSF7)
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CGCGAACATAAGAAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
355127 | 10 µg | 296€ |
CD70, also known as CD27L, is a 50 kD type II transmembrane glycoprotein and member of the tumor necrosis factor superfamily. CD70 is expressed on activated T, B and NK cells, activated plasmacytoid dendritic cells (pDCs), and chronic B cell lymphocytic leukemia and large B cell lymphomas. CD70 costimulates T cell proliferation and differentiation. It plays a role in the pDC-induced B cell differentiation. The ligand of CD70 is CD27.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- CD70-transfected L cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications for the relevant formats include: blocking of plasmacytoid dendritic cell induced B cell proliferation and Ig secretion1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Shaw J, et al. 2010. Blood 115:3051. (Block)
- RRID
-
AB_2922571 (BioLegend Cat. No. 355127)
Antigen Details
- Structure
- Type II transmembrane glycoprotein, member of the tumor necrosis factor superfamily, 50 kD
- Distribution
-
Activated T cells and B cells, activated NK cells, activated plasmacytoid dendritic cells, some B cell lymphomas
- Function
- Role in T cell proliferation, generation of cytolytic and memory T cells, B cell proliferation and differentiation
- Ligand/Receptor
- CD27
- Cell Type
- B cells, Dendritic cells, NK cells, T cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Bowman MR, et al. 1994. J. Immunol. 152:1756.
2. Shaw J, et al. 2010. Blood 115:3051.
3. Keller AM, et al. 2009. Blood 113:5167. - Gene ID
- 970 View all products for this Gene ID
- UniProt
- View information about CD70 on UniProt.org
Related FAQs
Other Formats
View All CD70 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD70 | 113-16 | FC |
PE anti-human CD70 | 113-16 | FC |
FITC anti-human CD70 | 113-16 | FC |
PerCP/Cyanine5.5 anti-human CD70 | 113-16 | FC |
APC anti-human CD70 | 113-16 | FC |
Alexa Fluor® 647 anti-human CD70 | 113-16 | FC |
PE/Cyanine7 anti-human CD70 | 113-16 | FC |
Biotin anti-human CD70 | 113-16 | FC |
TotalSeq™-A0027 anti-human CD70 | 113-16 | PG |
TotalSeq™-C0027 anti-human CD70 | 113-16 | PG |
APC/Fire™ 750 anti-human CD70 | 113-16 | FC |
PE/Dazzle™ 594 anti-human CD70 | 113-16 | FC |
TotalSeq™-B0027 anti-human CD70 | 113-16 | PG |
TotalSeq™-D0027 anti-human CD70 | 113-16 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD70
-
PE anti-human CD70
-
FITC anti-human CD70
-
PerCP/Cyanine5.5 anti-human CD70
-
APC anti-human CD70
-
Alexa Fluor® 647 anti-human CD70
-
PE/Cyanine7 anti-human CD70
-
Biotin anti-human CD70
-
TotalSeq™-A0027 anti-human CD70
-
TotalSeq™-C0027 anti-human CD70
-
APC/Fire™ 750 anti-human CD70
-
PE/Dazzle™ 594 anti-human CD70
-
TotalSeq™-B0027 anti-human CD70
-
TotalSeq™-D0027 anti-human CD70
Follow Us