TotalSeq™-D0027 anti-human CD70 Antibody

Pricing & Availability
113-16 (See other available formats)
Regulatory Status
Other Names
CD27 ligand, CD27L, Ki-24 antigen, Tumor necrosis factor ligand superfamily, member 7 (TNFSF7)
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
355127 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD70, also known as CD27L, is a 50 kD type II transmembrane glycoprotein and member of the tumor necrosis factor superfamily. CD70 is expressed on activated T, B and NK cells, activated plasmacytoid dendritic cells (pDCs), and chronic B cell lymphocytic leukemia and large B cell lymphomas. CD70 costimulates T cell proliferation and differentiation. It plays a role in the pDC-induced B cell differentiation. The ligand of CD70 is CD27.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Antibody Type
Host Species
CD70-transfected L cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications for the relevant formats include: blocking of plasmacytoid dendritic cell induced B cell proliferation and Ig secretion1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Shaw J, et al. 2010. Blood 115:3051. (Block)
AB_2922571 (BioLegend Cat. No. 355127)

Antigen Details

Type II transmembrane glycoprotein, member of the tumor necrosis factor superfamily, 50 kD

Activated T cells and B cells, activated NK cells, activated plasmacytoid dendritic cells, some B cell lymphomas

Role in T cell proliferation, generation of cytolytic and memory T cells, B cell proliferation and differentiation
Cell Type
B cells, Dendritic cells, NK cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Bowman MR, et al. 1994. J. Immunol. 152:1756.
2. Shaw J, et al. 2010. Blood 115:3051.
3. Keller AM, et al. 2009. Blood 113:5167.

Gene ID
970 View all products for this Gene ID
View information about CD70 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03.22.2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD70

  • PE anti-human CD70

  • FITC anti-human CD70

  • PerCP/Cyanine5.5 anti-human CD70

  • APC anti-human CD70

  • Alexa Fluor® 647 anti-human CD70

  • PE/Cyanine7 anti-human CD70

  • Biotin anti-human CD70

  • TotalSeq™-A0027 anti-human CD70

  • TotalSeq™-C0027 anti-human CD70

  • APC/Fire™ 750 anti-human CD70

  • PE/Dazzle™ 594 anti-human CD70

  • TotalSeq™-B0027 anti-human CD70

  • TotalSeq™-D0027 anti-human CD70


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account