TotalSeq™-D0159 anti-human HLA-DR Antibody

Pricing & Availability
L243 (See other available formats)
Regulatory Status
Other Names
Major Histocompatibility Class II, MHC class II
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
307681 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

HLA-DR is a heterodimeric cell surface glycoprotein comprised of a 36 kD α (heavy) chain and a 27 kD β (light) chain. It is expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In conjunction with the CD3/TCR complex and CD4 molecules, HLA-DR is critical for efficient peptide presentation to CD4+ T cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Chimpanzee, Dog, Common Marmoset, Squirrel Monkey, Cotton-topped Tamarin
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The L243 monoclonal antibody reacts with the HLA-DR antigen, a member of MHC class II molecules. It does not cross react with HLA-DP and HLA-DQ. Clone L243 binds a conformational epitope on HLA-DRa which depends on the correct folding of the aß heterodimer.19

Additional reported applications (for the relevant formats) include: immunoprecipitation8, Western blotting8, in vitro blocking of mixed lymphocyte reactions9,10, depeletion of MHC class II cells7, immunohistochemical staining of acetone-fixed frozen sections4,5, and spatial biology (IBEX)21,22. For sensitive functional assays, we recommend using the Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) (Cat. No. 307648, 307665 - 307669).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Brodsky F. 1984. Immunogenetics 19:179.
  2. Robbins P, et al. 1987. Human Immunol. 18:301.
  3. Stites D, et al. 1986. Clin. Immunol. Immunopathol. 38:161.
  4. Warnke R, et al. 1980. J. Histochem. Cytochem. 28:771. (IHC)
  5. Engleman E, et al. 1981. P. Natl. Acad. Sci. USA 78:1791. (IHC)
  6. Zipf T, et al. 1981. Cancer Res. 41:4786.
  7. Goodier M, et al. 2000. J. Immunol. 165:139. (Depletion)
  8. Esser M, et al. 2001. J. Virol. 75:6173. (IP, WB)
  9. Kalka-Moll WM, et al. 2002. J. Immunol. 169:6149. (Block)
  10. Wang RF, et al. 1999. Science 284:1351. (Block)
  11. Zaba LC, et al. 2007. J. Exp. Med. 204:3183. PubMed
  12. Fujita H, et al. 2009. P. Natl. Acad. Sci. USA 106:21795. PubMed
  13. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  14. Goncalves RM, et al. 2010. Infect. Immun. 78:4763. PubMed
  15. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  16. Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
  17. Stein R, et al. 2011. Leuk. Lymphoma 52:273.
  18. Galkowska H, et al. 1996. Vet. Immunol. Immunopathol. 53:329.
  19. Moro M, et al. 2005. BMC Immunol. 6:24.
  20. Lauterbach N, et al. 2014. Mol Immunol. 59:19. PubMed
  21. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  22. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2892373 (BioLegend Cat. No. 307681)

Antigen Details

Ig superfamily, MHC class II, heterodimeric transmembrane protein, 36 kD heavy and 27 kD light chain

B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs

Peptide presentation
Cell Type
Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Levacher M, et al. 1990. Clin. Exp. Immunol. 81:177.
2. Terstappen L, et al. 1990. J. Leukocyte Biol. 48:138.
3. Edwards JA, et al. 1986. J. Immunol. 137:490.
4. van Es A, et al. 1984. Transplantation 37:65.
5. O'Doherty U, et al. 1994. Immunology 82:487.
6. Thomas R, et al. 1994. J. Immunol. 153:4016.
7. Grouard G, et al. 1996. Nature 384:364.

Gene ID
3122 View all products for this Gene ID 3123 View all products for this Gene ID
View information about HLA-DR on

Related FAQs

There are no FAQs for this product.

Other Formats

View All HLA-DR Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human HLA-DR L243 FC
FITC anti-human HLA-DR L243 FC
PE anti-human HLA-DR L243 FC
PE/Cyanine5 anti-human HLA-DR L243 FC
Purified anti-human HLA-DR L243 FC, CyTOF®, IP, WB, Block, IHC-F
Biotin anti-human HLA-DR L243 FC
PE/Cyanine7 anti-human HLA-DR L243 FC
APC/Cyanine7 anti-human HLA-DR L243 FC
Alexa Fluor® 488 anti-human HLA-DR L243 FC, SB
Alexa Fluor® 647 anti-human HLA-DR L243 FC
Pacific Blue™ anti-human HLA-DR L243 FC
Alexa Fluor® 700 anti-human HLA-DR L243 FC
PerCP anti-human HLA-DR L243 FC
PerCP/Cyanine5.5 anti-human HLA-DR L243 FC
Brilliant Violet 605™ anti-human HLA-DR L243 FC
Brilliant Violet 421™ anti-human HLA-DR L243 FC
Brilliant Violet 570™ anti-human HLA-DR L243 FC
Brilliant Violet 711™ anti-human HLA-DR L243 FC
Brilliant Violet 785™ anti-human HLA-DR L243 FC
Brilliant Violet 510™ anti-human HLA-DR L243 FC
Ultra-LEAF™ Purified anti-human HLA-DR L243 FC, CyTOF®, IP, WB, Block, IHC-F
Brilliant Violet 650™ anti-human HLA-DR L243 FC
Purified anti-human HLA-DR (Maxpar® Ready) L243 FC, CyTOF®
PE/Dazzle™ 594 anti-human HLA-DR L243 FC
FITC anti-human HLA-DR L243 FC
APC/Fire™ 750 anti-human HLA-DR L243 FC
Pacific Blue™ anti-human HLA-DR L243 FC
APC anti-human HLA-DR L243 FC
PE/Dazzle™ 594 anti-human HLA-DR L243 FC
PE/Cyanine7 anti-human HLA-DR L243 FC
TotalSeq™-A0159 anti-human HLA-DR L243 PG
TotalSeq™-B0159 anti-human HLA-DR L243 PG
TotalSeq™-C0159 anti-human HLA-DR L243 PG
Brilliant Violet 750™ anti-human HLA-DR L243 FC
APC/Fire™ 750 anti-human HLA-DR L243 FC
PerCP/Cyanine5.5 anti-human HLA-DR L243 FC
APC/Fire™ 810 anti-human HLA-DR L243 FC
PE/Fire™ 640 anti-human HLA-DR L243 FC
PE anti-human HLA-DR L243 FC
Spark Violet™ 538 anti-human HLA-DR Antibody L243 FC
KIRAVIA Blue 520™ anti-human HLA-DR L243 FC
TotalSeq™-D0159 anti-human HLA-DR L243 PG
PE/Fire™ 810 anti-human HLA-DR L243 FC
GMP PE/Dazzle™ 594 anti-human HLA-DR L243 FC
Spark Violet™ 423 anti-human HLA-DR L243 FC
PerCP anti-human HLA-DR L243 FC
GMP FITC anti-human HLA-DR L243 FC
GMP APC anti-human HLA-DR L243 FC
GMP PE/Cyanine7 anti-human HLA-DR L243 FC
GMP Pacific Blue™ anti-human HLA-DR L243 FC
GMP APC/Fire™ 750 anti-human HLA-DR L243 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human HLA-DR

  • FITC anti-human HLA-DR

  • PE anti-human HLA-DR

  • PE/Cyanine5 anti-human HLA-DR

  • Purified anti-human HLA-DR

  • Biotin anti-human HLA-DR

  • PE/Cyanine7 anti-human HLA-DR

  • APC/Cyanine7 anti-human HLA-DR

  • Alexa Fluor® 488 anti-human HLA-DR

  • Alexa Fluor® 647 anti-human HLA-DR

  • Pacific Blue™ anti-human HLA-DR

  • Alexa Fluor® 700 anti-human HLA-DR

  • PerCP anti-human HLA-DR

  • PerCP/Cyanine5.5 anti-human HLA-DR

  • Brilliant Violet 605™ anti-human HLA-DR

  • Brilliant Violet 421™ anti-human HLA-DR

  • Brilliant Violet 570™ anti-human HLA-DR

  • Brilliant Violet 711™ anti-human HLA-DR

  • Brilliant Violet 785™ anti-human HLA-DR

  • Brilliant Violet 510™ anti-human HLA-DR

  • Ultra-LEAF™ Purified anti-human HLA-DR

  • Brilliant Violet 650™ anti-human HLA-DR

  • Purified anti-human HLA-DR (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human HLA-DR

  • FITC anti-human HLA-DR

  • APC/Fire™ 750 anti-human HLA-DR

  • Pacific Blue™ anti-human HLA-DR

  • APC anti-human HLA-DR

  • PE/Dazzle™ 594 anti-human HLA-DR

  • PE/Cyanine7 anti-human HLA-DR

  • TotalSeq™-A0159 anti-human HLA-DR

  • TotalSeq™-B0159 anti-human HLA-DR

  • TotalSeq™-C0159 anti-human HLA-DR

  • Brilliant Violet 750™ anti-human HLA-DR

  • APC/Fire™ 750 anti-human HLA-DR

  • PerCP/Cyanine5.5 anti-human HLA-DR

  • APC/Fire™ 810 anti-human HLA-DR

  • PE/Fire™ 640 anti-human HLA-DR

  • PE anti-human HLA-DR

  • Spark Violet™ 538 anti-human HLA-DR Antibody

  • KIRAVIA Blue 520™ anti-human HLA-DR

  • TotalSeq™-D0159 anti-human HLA-DR

  • PE/Fire™ 810 anti-human HLA-DR

  • GMP PE/Dazzle™ 594 anti-human HLA-DR

  • Spark Violet™ 423 anti-human HLA-DR

  • PerCP anti-human HLA-DR

  • GMP FITC anti-human HLA-DR

  • GMP APC anti-human HLA-DR

  • GMP PE/Cyanine7 anti-human HLA-DR

  • GMP Pacific Blue™ anti-human HLA-DR

  • GMP APC/Fire™ 750 anti-human HLA-DR


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account