TotalSeq™-D0147 anti-human CD62L Antibody

Pricing & Availability
DREG-56 (See other available formats)
Regulatory Status
V S056
Other Names
L-selectin, LECAM-1, LAM-1, Leu-8, TQ-1
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
304863 10 µg $358
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD62L is a 74-95 kD single chain type I glycoprotein referred to as L-selectin or LECAM-1. It is expressed on most peripheral blood B cells, subsets of T and NK cells, monocytes, granulocytes, and certain hematopoietic malignant cells. CD62L binds to carbohydrates present on certain glycoforms of CD34, glycam-1, and MAdCAM-1 and with a low affinity to anionic oligosaccharide sequences related to sialylated Lewis X (sLex, CD15s) through its C-type lectin domain. CD62L is important for the homing of naïve lymphocytes to high endothelial venules in peripheral lymph nodes and Peyer's patches. It also plays a role in leukocyte rolling on activated endothelial cells.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Reported Reactivity
Chimpanzee, Cow
Antibody Type
Host Species
Concentrated supernatant from PMA-activated human peripheral blood leukocytes
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting2,3,9 and in vitro blocking of lymphocytes binding to high endothelial venules (HEV)2. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 304853-304858).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Kishimoto TK, et al. 1990. Proc. Natl. Acad. Sci. USA 87:2244. (WB, Block)
  3. Jutila M, et al. 2002. J. Immunol. 169:1768. (WB)
  4. Tamassia N, et al. 2008. J. Immunol. 181:6563. (FC) PubMed
  5. Kmieciak M, et al. 2009. J. Transl. Med. 7:89. (FC) PubMed
  6. Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
  7. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  9. Koenig JM, et al. 1996. Pediatr. Res. 39:616. (WB)
  10. Shi C, et al. 2011. J. Immunol. 187:5293. (FC) PubMed
  11. Burges M, et al. 2013. Clin Cancer Res. 19:5675. PubMed
  12. Cash JL, et al. 2013. EMBO Rep. 14:999. (FC) PubMed
AB_2894612 (BioLegend Cat. No. 304863)

Antigen Details

Selectin, single chain glycoprotein, 74-95 kD

Majority of B cells, naïve T cells, subset of memory T and NK cells, monocytes, granulocytes, thymocytes

Leukocyte homing, leukocyte tethering, rolling
CD34, GlyCAM, MAdCAM-1
Cell Type
B cells, Granulocytes, Monocytes, Neutrophils, NK cells, T cells, Thymocytes, Tregs
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References
  1. Kishimoto T, et al. 1990. P. Natl. Acad. Sci. USA 87:2244.
  2. Kishimoto T, et al. 1991. Blood 78:805.


Gene ID
6402 View all products for this Gene ID
View information about CD62L on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/16/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD62L

  • FITC anti-human CD62L

  • PE anti-human CD62L

  • PE/Cyanine5 anti-human CD62L

  • Purified anti-human CD62L

  • APC/Cyanine7 anti-human CD62L

  • Alexa Fluor® 488 anti-human CD62L

  • Alexa Fluor® 647 anti-human CD62L

  • Alexa Fluor® 700 anti-human CD62L

  • PE/Cyanine7 anti-human CD62L

  • PerCP/Cyanine5.5 anti-human CD62L

  • Pacific Blue™ anti-human CD62L

  • Brilliant Violet 421™ anti-human CD62L

  • Brilliant Violet 785™ anti-human CD62L

  • Brilliant Violet 650™ anti-human CD62L

  • PE/Dazzle™ 594 anti-human CD62L

  • Brilliant Violet 605™ anti-human CD62L

  • Purified anti-human CD62L (Maxpar® Ready)

  • APC/Fire™ 750 anti-human CD62L

  • Brilliant Violet 510™ anti-human CD62L

  • TotalSeq™-A0147 anti-human CD62L

  • TotalSeq™-B0147 anti-human CD62L

  • TotalSeq™-C0147 anti-human CD62L

  • Ultra-LEAF™ Purified anti-human CD62L

  • Brilliant Violet 711™ anti-human CD62L

  • Spark NIR™ 685 anti-human CD62L

  • TotalSeq™-D0147 anti-human CD62L

  • APC/Fire™ 810 anti-human CD62L


Remember me
Forgot your password? Reset Password
Request an Account