TotalSeq™-A0155 anti-human CD107a (LAMP-1) Antibody

Pricing & Availability
Clone
H4A3 (See other available formats)
Workshop
P PR-63; BP 473; P P008
Other Names
Lysosome-Associated Membrane Protein 1, LGP-120, LAMP-1
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
328647 10 µg $325
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD107a, also known as Lysosome-Associated Membrane Protein 1 (LAMP-1) or LGP-120, is a 110-140 kD type I membrane glycoprotein. Mature CD107a is heavily glycosylated from a 40 kD core protein. This molecule is located on the luminal side of lysosomes. Upon activation, CD107a is transferred to the cell membrane surface of activated platelets, activated lymphocytes, macrophages, epithelial cells, endothelial cells, and some tumor cells. CD107a has been suggested to play a role in the protection of lysosomal membrane from lysosomal hydrolases which is involved in cell adhesion and regulation of tumor metastasis, and mediates autoimmune disease progression. CD107a is a ligand for galaptin and E-selectin. Surface expression of LAMP-1 has been shown to correlate with CD8+ T cell and NK cell cytotoxicity.

Product Details
Technical data sheet

Product Details

Reactivity
Human, African Green, Baboon, Chimpanzee, Cynomolgus, Pigtailed Macaque, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human adult adherent peripheral blood cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting8, immunohistochemical staining2, immunofluorescence5,7, and immunoprecipitation5.

This antibody is specific to human LAMP-1. Positive control: Hela cells; LAMP-1 molecular weight appears to be at ~110 kDa on the gel due to high glycosylation.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone H4A3 is CAGCCCACTGCAATA.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CAGCCCACTGCAATA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Misse D, et al. 1999. Blood 93:2454.
  2. Furuta K, et al. 2001. Am. J. Pathol. 159:449. (IHC)
  3. Watanabe A, et al. 2011. J. Biol. Chem. 286:10702. PubMed
  4. Baron Gaillard CL, et al. 2011. Mol. Cell. Biol. 22:5459. PubMed
  5. Hauck CR and Meyer TF. 1997. FEBS Lett. 405:86. (IF, IP)
  6. De Keersmaecker B, et al. 2012. J. Virol. 86:9351. PubMed
  7. Knodler LA, et al. 2010. P. Natl. Acad. Sci. USA. 107:17733. (IF)
  8. Oh J, et al. 2000. Hum. Mol. Genet. 9:375. (WB)
  9. Salio M, et al. 2013 PNAS. 110:4753. PubMed
RRID
AB_2750351 (BioLegend Cat. No. 328647)

Antigen Details

Structure
LAMP-1 is a 417 amino acid protein with a molecular mass of 45 kD.
Distribution

Macrophages, epithelial cells, endothelial cells, some tumor cells; located on the luminal side of lysosomes or on the surface of cell membranes

Function
Protect lysosomal membrane from lysosomal hydrolases, adhesion
Ligand Receptor
Galaptin
Biology Area
Cell Biology, Immunology, Neurodegeneration, Neuroscience, Protein Trafficking and Clearance
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Sarafian V, et al. 2006. Arch. Dermatol. Res. 298:7381.
2. Schlossman SF, et al. 1995. Leukocyte Typing V:White Cell Differentiation Antigens. New York:Oxford University Press.
3. Sawada R, et al. 1993. J. Biol. Chem. 268:12675.
4. Chen JW, et al. 1988. J. Biol. Chem. 263:8754.
5. Chen JW, et al. 1986. Biochem. Soc. Symp. 51:97112.

Gene ID
3916 View all products for this Gene ID
UniProt
View information about CD107a on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09/26/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account