TotalSeq™-D0088 anti-human CD279 (PD-1) Antibody

Pricing & Availability
Clone
EH12.2H7 (See other available formats)
Regulatory Status
RUO
Other Names
PD-1, PDCD1
Isotype
Mouse IgG1, κ
Barcode Sequence
ACAGCGCCGTATTTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
329969 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Programmed cell death 1 (PD-1), also known as CD279, is a 55 kD member of the immunoglobulin superfamily. CD279 contains the immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic region and plays a key role in peripheral tolerance and autoimmune disease. CD279 is expressed predominantly on activated T cells, B cells, and myeloid cells. PD-L1 (B7-H1) and PD-L2 (B7-DC) are ligands of CD279 (PD-1) and are members of the B7 gene family. Evidence suggests overlapping functions for these two PD-1 ligands and their constitutive expression on some normal tissues and upregulation on activated antigen-presenting cells. Interaction of CD279 ligands results in inhibition of T cell proliferation and cytokine secretion.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Chimpanzee, Common Marmoset, Cynomolgus, Rhesus, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking of ligand binding1-3, immunohistochemical staining of paraformaldehyde fixed frozen sections13, and spatial biology (IBEX)15,16. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 329911 and 329912). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 329926) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Dorfman DM, et al. 2006 Am. J. Surg. Pathol. 30:802. (FA)
  2. Radziewicz H, et al. 2007. J. Virol. 81:2545. (FA)
  3. Velu V, et al. 2007. J. Virol. 81:5819. (FA)
  4. Zahn RC, et al. 2008. J. Virol. 82:11577. PubMed
  5. Chang WS, et al. 2008. J. Immunol. 181:6707. (FC) PubMed
  6. Nakamoto N, et al. 2009. PLoS Pathog. 5:e1000313. (FA)
  7. Jones RB, et al. 2009. J. Virol. 83:8722. (FC) PubMed
  8. Vojnov L, et al. 2010. J. Virol. 84:753. (FC) PubMed
  9. Radziewicz H, et al. 2010. J. Immunol. 184:2410. (FC) PubMed
  10. Monteriro P, et al. 2011. J. Immunol. 186:4618. PubMed
  11. Conrad J, et al. 2011. J. Immunol. 186:6871. PubMed
  12. Salisch NC, et al. 2010. J. Immunol. 184:476. (Rhesus reactivity)
  13. Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC)
  14. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  15. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  16. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2894607 (BioLegend Cat. No. 329969)

Antigen Details

Structure
Immunoglobulin superfamily
Distribution

Transiently expressed on CD4- CD8- thymocytes; upregulated in thymocytes and splenic T and B lymphocytes; expressed on activated myeloid cells

Ligand/Receptor
B7-H1 (also known as PD-L1) and B7-DC (PD-L2)
Cell Type
B cells, Lymphocytes, T cells, Thymocytes, Tregs
Biology Area
Cancer Biomarkers, Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Gene ID
5133 View all products for this Gene ID
UniProt
View information about CD279 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD279 Reagents Request Custom Conjugation
Description Clone Applications
Brilliant Violet 421™ anti-human CD279 (PD-1) EH12.2H7 FC
Purified anti-human CD279 (PD-1) EH12.2H7 FC,Block,IHC-F
FITC anti-human CD279 (PD-1) EH12.2H7 FC
PE anti-human CD279 (PD-1) EH12.2H7 FC,SB
APC anti-human CD279 (PD-1) EH12.2H7 FC
Alexa Fluor® 647 anti-human CD279 (PD-1) EH12.2H7 FC
PerCP/Cyanine5.5 anti-human CD279 (PD-1) EH12.2H7 FC
APC/Cyanine7 anti-human CD279 (PD-1) EH12.2H7 FC
Pacific Blue™ anti-human CD279 (PD-1) EH12.2H7 FC
PE/Cyanine7 anti-human CD279 (PD-1) EH12.2H7 FC
Purified anti-human CD279 (PD-1) (Maxpar® Ready) EH12.2H7 FC,CyTOF®
Brilliant Violet 605™ anti-human CD279 (PD-1) EH12.2H7 FC
Ultra-LEAF™ Purified anti-human CD279 (PD-1) EH12.2H7 FC,Block,IHC-F
Brilliant Violet 711™ anti-human CD279 (PD-1) EH12.2H7 FC
Brilliant Violet 785™ anti-human CD279 (PD-1) EH12.2H7 FC
Brilliant Violet 510™ anti-human CD279 (PD-1) EH12.2H7 FC
Biotin anti-human CD279 (PD-1) EH12.2H7 FC
PE/Dazzle™ 594 anti-human CD279 (PD-1) EH12.2H7 FC
Alexa Fluor® 488 anti-human CD279 (PD-1) EH12.2H7 FC
PerCP anti-human CD279 (PD-1) EH12.2H7 FC
GoInVivo™ Purified anti-human CD279 (PD-1) EH12.2H7 FC,Block,IHC
Brilliant Violet 650™ anti-human CD279 (PD-1) EH12.2H7 FC
Alexa Fluor® 700 anti-human CD279 (PD-1) EH12.2H7 FC
APC/Fire™ 750 anti-human CD279 (PD-1) EH12.2H7 FC
TotalSeq™-A0088 anti-human CD279 (PD-1) EH12.2H7 PG
TotalSeq™-B0088 anti-human CD279 (PD-1) EH12.2H7 PG
TotalSeq™-C0088 anti-human CD279 (PD-1) EH12.2H7 PG
Brilliant Violet 750™ anti-human CD279 (PD-1) EH12.2H7 FC
TotalSeq™-D0088 anti-human CD279 (PD-1) EH12.2H7 PG
PE/Fire™ 640 anti-human CD279 (PD-1) EH12.2H7 FC
PE/Cyanine5 anti-human CD279 (PD-1) EH12.2H7 FC
PE/Fire™ 744 anti-human CD279 (PD-1) EH12.2H7 FC
Spark Red™ 718 anti-human CD279 (PD-1) EH12.2H7 FC
Brilliant Violet 570™ anti-human CD279 (PD-1) EH12.2H7 FC
Spark NIR™ 685 anti-human CD279 (PD-1) Antibody EH12.2H7 FC
Go To Top Version: 1    Revision Date: 08/12/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account