TotalSeq™-D0359 anti-human CD83 Antibody

Pricing & Availability
HB15e (See other available formats)
Regulatory Status
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
305345 10 µg £253
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD83 is a 43 kD single chain type I glycoprotein also known as HB15. A member of the immunoglobulin superfamily, CD83 is expressed on a subset of dendritic cells, Langerhans cells, and weakly on activated lymphocytes. Although CD83 is thought to play a role in antigen presentation and/or lymphocyte activation, the precise function of this protein is unknown. CD83 is considered to be a useful marker for mature dendritic cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Pigtailed Macaque, Rhesus
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections4.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press New York.
  2. Zhou L, et al. 1995. J. Immunol. 154:3821.
  3. Cao W, et al. 2005. Biochem. J. 385:85.
  4. Lore K, et al. 2002. AIDS 16:683. (IHC)
  5. Cho H, et al. 2007. Physiol Genomics doi:10.1152/physiolgenomics.00051.2006
AB_2892362 (BioLegend Cat. No. 305345)

Antigen Details

Ig superfamily, single chain transmembrane glycoprotein, 43 kD

Dendritic cells, Langerhan cells, activated B and T cells

Cell Type
B cells, Dendritic cells, Langerhans cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Kozlow E, et al. 1993. Blood 81:454.
2. Zhou L, et al. 1992. J. Immunol. 149:735.
3. Zhou L, et al. 1995. Blood 86:3295.

Gene ID
9308 View all products for this Gene ID
View information about CD83 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD83

  • Biotin anti-human CD83

  • FITC anti-human CD83

  • PE anti-human CD83

  • PE/Cyanine5 anti-human CD83

  • Purified anti-human CD83

  • Alexa Fluor® 488 anti-human CD83

  • Alexa Fluor® 647 anti-human CD83

  • PerCP/Cyanine5.5 anti-human CD83

  • Brilliant Violet 421™ anti-human CD83

  • PE/Cyanine7 anti-human CD83

  • PE/Dazzle™ 594 anti-human CD83

  • APC/Cyanine7 anti-human CD83

  • Brilliant Violet 711™ anti-human CD83

  • APC/Fire™ 750 anti-human CD83

  • Brilliant Violet 605™ anti-human CD83

  • Brilliant Violet 785™ anti-human CD83

  • TotalSeq™-A0359 anti-human CD83

  • TotalSeq™-C0359 anti-human CD83

  • TotalSeq™-B0359 anti-human CD83

  • TotalSeq™-D0359 anti-human CD83


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account