TotalSeq™-D0061 anti-human CD117 (c-kit) Antibody

Pricing & Availability
104D2 (See other available formats)
Regulatory Status
Other Names
Stem cell factor receptor, c-kit, mast cell growth factor receptor, steel factor receptor
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
313251 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD117 is a 145 kD protein tyrosine kinase also known as c-Kit. It is a receptor for stem cell factor or c-Kit ligand. CD117 is expressed on pluripotent hematopoietic progenitor cells (approximately 1-4% bone marrow cells), mast cells, and acute myeloid leukemia cells (AML). CD117 binding of c-Kit ligand induces phosphorylation of CD117 and stimulates proliferation and survival of primitive hematopoietic stem cells as well as erythroid-committed and granulo-monocytic committed cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Cynomolgus, Cow
Antibody Type
Host Species
MOLM-1 megakaryocytic cell line
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 104D2 antibody does not block binding of c-Kit ligand. Additional reported applications (for the relevant formats) include: immunoprecipitation1, immunofluorescence microscopy1, and spatial biology (IBEX)4,5.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Broudy VC, et al. 1999. Blood 94:1979. (IF, IP)
  2. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  3. Nagano M, et al. 2007. Blood 110:151. (FC) PubMed
  4. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  5. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2904340 (BioLegend Cat. No. 313251)

Antigen Details

Growth factor receptor with tyrosine kinase activity, subclass III, approximately 145 kD

Pluripotent hematopoietic progenitor cells (approximately 1-4% bone marrow cells), mast cells, acute myeloid leukemic cells (AML)

Growth factor receptor for stem cell factor. Induces proliferation and survival of primitive hematopoietic progenitors. Potent inducer of proliferation in erythroid-committed progenitor cells. Defects in CD117 have been linked to severe anemia and a decreased number of hematopoietic progenitor cells.
c-Kit ligand
Multiple phosphorylation sites
Cell Type
Embryonic Stem Cells, Hematopoietic stem and progenitors, Leukemia, Mast cells, Mesenchymal Stem Cells
Biology Area
Immunology, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Giebel LB, et al. 1992. Oncogene 7:2207.
2. Furitsu T, et al. 1993. J. Clin. Invest. 92:1736.

Gene ID
3815 View all products for this Gene ID
View information about CD117 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD117 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD117 (c-kit) 104D2 FC, CyTOF®, ICC, IP
PE anti-human CD117 (c-kit) 104D2 FC, SB
APC anti-human CD117 (c-kit) 104D2 FC
Biotin anti-human CD117 (c-kit) 104D2 FC
PE/Cyanine5 anti-human CD117 (c-kit) 104D2 FC
PE/Cyanine7 anti-human CD117 (c-kit) 104D2 FC
PerCP/Cyanine5.5 anti-human CD117 (c-kit) 104D2 FC
Brilliant Violet 421™ anti-human CD117 (c-kit) 104D2 FC
Brilliant Violet 605™ anti-human CD117 (c-kit) 104D2 FC
Brilliant Violet 510™ anti-human CD117 (c-kit) 104D2 FC
Brilliant Violet 650™ anti-human CD117 (c-kit) 104D2 FC
Purified anti-human CD117 (c-kit) (Maxpar® Ready) 104D2 FC, CyTOF®
PE/Dazzle™ 594 anti-human CD117 (c-kit) 104D2 FC
APC/Cyanine7 anti-human CD117 (c-kit) 104D2 FC
Brilliant Violet 711™ anti-human CD117 (c-kit) 104D2 FC
FITC anti-human CD117 (c-kit) 104D2 FC
Alexa Fluor® 488 anti-human CD117 (c-kit) 104D2 FC, SB
Alexa Fluor® 647 anti-human CD117 (c-kit) 104D2 FC
APC/Fire™ 750 anti-human CD117 (c-kit) 104D2 FC
Brilliant Violet 785™ anti-human CD117 (c-kit) 104D2 FC
PE anti-human CD117 (c-kit) 104D2 FC
APC anti-human CD117 (c-kit) 104D2 FC
TotalSeq™-A0061 anti-human CD117 (c-kit) 104D2 PG
TotalSeq™-C0061 anti-human CD117 (c-kit) 104D2 PG
TotalSeq™-B0061 anti-human CD117 (c-kit) 104D2 PG
Alexa Fluor® 700 anti-human CD117 (c-kit) 104D2 FC
Spark NIR™ 685 anti-human CD117 (c-kit) Antibody 104D2 FC
APC/Fire™ 750 anti-human CD117 (c-kit) 104D2 FC
TotalSeq™-D0061 anti-human CD117 (c-kit) 104D2 PG
PE/Cyanine7 anti-human CD117 (c-kit) 104D2 FC
PE/Dazzle™ 594 anti-human CD117 (c-kit) 104D2 FC
PerCP/Cyanine5.5 anti-human CD117 (c-kit) 104D2 FC
GMP APC anti-human CD117 (c-kit) 104D2 FC
GMP PE anti-human CD117 (c-kit) 104D2 FC
Go To Top Version: 1    Revision Date: 11-05-2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD117 (c-kit)

  • PE anti-human CD117 (c-kit)

  • APC anti-human CD117 (c-kit)

  • Biotin anti-human CD117 (c-kit)

  • PE/Cyanine5 anti-human CD117 (c-kit)

  • PE/Cyanine7 anti-human CD117 (c-kit)

  • PerCP/Cyanine5.5 anti-human CD117 (c-kit)

  • Brilliant Violet 421™ anti-human CD117 (c-kit)

  • Brilliant Violet 605™ anti-human CD117 (c-kit)

  • Brilliant Violet 510™ anti-human CD117 (c-kit)

  • Brilliant Violet 650™ anti-human CD117 (c-kit)

  • Purified anti-human CD117 (c-kit) (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD117 (c-kit)

  • APC/Cyanine7 anti-human CD117 (c-kit)

  • Brilliant Violet 711™ anti-human CD117 (c-kit)

  • FITC anti-human CD117 (c-kit)

  • Alexa Fluor® 488 anti-human CD117 (c-kit)

  • Alexa Fluor® 647 anti-human CD117 (c-kit)

  • APC/Fire™ 750 anti-human CD117 (c-kit)

  • Brilliant Violet 785™ anti-human CD117 (c-kit)

  • PE anti-human CD117 (c-kit)

  • APC anti-human CD117 (c-kit)

  • TotalSeq™-A0061 anti-human CD117 (c-kit)

  • TotalSeq™-C0061 anti-human CD117 (c-kit)

  • TotalSeq™-B0061 anti-human CD117 (c-kit)

  • Alexa Fluor® 700 anti-human CD117 (c-kit)

  • Spark NIR™ 685 anti-human CD117 (c-kit) Antibody

  • APC/Fire™ 750 anti-human CD117 (c-kit)

  • TotalSeq™-D0061 anti-human CD117 (c-kit)

  • PE/Cyanine7 anti-human CD117 (c-kit)

  • PE/Dazzle™ 594 anti-human CD117 (c-kit)

  • PerCP/Cyanine5.5 anti-human CD117 (c-kit)

  • GMP APC anti-human CD117 (c-kit)

  • GMP PE anti-human CD117 (c-kit)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account