- Clone
- 5-271 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- GPIIIb, GPIV
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TTCTTTGCCTTGCCA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD36 is an 85 kD integral membrane glycoprotein, also known as GPIIIb, or GPIV. It is expressed on various epithelial and endothelial cells as well as erythrocytes, platelets, macrophages/monocytes and some macrophage-derived dendritic cells. CD36 functions as a scavenger receptor, binding thrombospondin, long chain fatty acids, oxidized LDL, collagen type I, IV, and V as well as apoptotic cells. The 5-271 antibody has been reported to be useful for flow cytometry.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human platelets
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG – Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescence2.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Stelner E, et al. 2006. J. Cell Sci. 119:459.
- Stewart DA, et al. 2012. Mol. Cancer Res. 10:727. (IF)
- RRID
-
AB_2904359 (BioLegend Cat. No. 336237)
Antigen Details
- Structure
- Integral membrane protein, CD36 family, single chain glycoprotein, 85-113 kD
- Distribution
-
Expressed in various epithelial and endothelial cells, erythrocytes, platelets, monocytes/ macrophages, some macrophage-derived dendritic cells
- Function
- Scavenger receptor for thrombospondin, long chain fatty acids, anionic phospholipids, oxidized LDL, collagen types I, IV and V. Involved in recognition and phagocytosis of apoptotic cells, cell adhesion.
- Ligand/Receptor
- Thrombospondin, anionic phospholipids, oxidized LDL, collage types I, IV, and V
- Cell Type
- Dendritic cells, Endothelial cells, Epithelial cells, Erythrocytes, Macrophages, Monocytes, Platelets
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules
- Antigen References
-
1. Hogg N, et al. 1984. Immunology 53-753.
2. Greenwalt DE, et al. 1992. Blood 80:1105.
3. Armsesilla AL, et al.1994. J. Biol. Chem. 269:18985.
4. Endemann G, et al. 1993. J. Biol. Chem. 268:11811. - Gene ID
- 948 View all products for this Gene ID
- UniProt
- View information about CD36 on UniProt.org
Other Formats
View All CD36 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD36 | 5-271 | FC,IHC-F,ICC |
APC anti-human CD36 | 5-271 | FC |
APC/Cyanine7 anti-human CD36 | 5-271 | FC |
FITC anti-human CD36 | 5-271 | FC |
PE anti-human CD36 | 5-271 | FC |
Purified anti-human CD36 (Maxpar® Ready) | 5-271 | FC,CyTOF® |
Biotin anti-human CD36 | 5-271 | FC |
APC/Fire™ 750 anti-human CD36 | 5-271 | FC |
PE/Cyanine7 anti-human CD36 | 5-271 | FC |
PerCP/Cyanine5.5 anti-human CD36 | 5-271 | FC |
TotalSeq™-A0407 anti-human CD36 | 5-271 | PG |
TotalSeq™-C0407 anti-human CD36 | 5-271 | PG |
Brilliant Violet 421™ anti-human CD36 | 5-271 | FC |
Alexa Fluor® 488 anti-human CD36 | 5-271 | FC |
TotalSeq™-B0407 anti-human CD36 | 5-271 | PG |
Alexa Fluor® 700 anti-human CD36 Antibody | 5-271 | FC |
TotalSeq™-D0407 anti-human CD36 | 5-271 | PG |
FITC anti-human CD36 | 5-271 | FC |
APC/Fire™ 750 anti-human CD36 | 5-271 | FC |
GMP FITC anti-human CD36 | 5-271 | FC |
GMP APC/Fire™ 750 anti-human CD36 | 5-271 | FC |
Spark YG™ 581 anti-human CD36 | 5-271 | FC |
Spark Red™ 718 anti-human CD36 (Flexi-Fluor™) | 5-271 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD36
-
APC anti-human CD36
-
APC/Cyanine7 anti-human CD36
-
FITC anti-human CD36
-
PE anti-human CD36
-
Purified anti-human CD36 (Maxpar® Ready)
-
Biotin anti-human CD36
-
APC/Fire™ 750 anti-human CD36
-
PE/Cyanine7 anti-human CD36
-
PerCP/Cyanine5.5 anti-human CD36
-
TotalSeq™-A0407 anti-human CD36
-
TotalSeq™-C0407 anti-human CD36
-
Brilliant Violet 421™ anti-human CD36
-
Alexa Fluor® 488 anti-human CD36
-
TotalSeq™-B0407 anti-human CD36
-
Alexa Fluor® 700 anti-human CD36 Antibody
-
TotalSeq™-D0407 anti-human CD36
-
FITC anti-human CD36
-
APC/Fire™ 750 anti-human CD36
-
GMP FITC anti-human CD36
-
GMP APC/Fire™ 750 anti-human CD36
-
Spark YG™ 581 anti-human CD36
-
Spark Red™ 718 anti-human CD36 (Flexi-Fluor™)
Follow Us