- Clone
- BA5b (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI N-L078
- Other Names
- ADA-binding protein, DPP IV ectoenzyme, EC 3.4.14.5
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- GGTGGCTAGATAATG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD26 is a 110 kD type II membrane protein also known as ADA-binding protein and dipeptidyl peptidase IV (DPPIV). It is a member of the peptidase and ectoenzyme family. CD26 is expressed on the membrane of mature thymocytes, T lymphocytes (upregulated upon activation), B cells, NK cells, and macrophages. CD26 cleaves off N-terminal X-Pro and X-Ala dipeptides from polypeptides. It plays an integral role as a costimulatory molecule in T cell activation. CD26 may interact with extracellular matrix proteins such as fibronectin or collagen, CD45 and ADA.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Press. London.
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- RRID
-
AB_2922532 (BioLegend Cat. No. 302729)
Antigen Details
- Structure
- Peptidases and ectoenzyme families, type II glycoprotein, 110 kD
- Distribution
-
Thymocyte subset, memory T cells, B cells, NK cells, epithelial cells, macrophages
- Function
- Dipeptidyl peptidase, T cell costimulation, HIV entry
- Ligand/Receptor
- Adenosine-deaminase, collagen
- Cell Type
- B cells, Epithelial cells, Macrophages, NK cells, T cells, Thymocytes
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Kameoka J, et al. 1993. Science 261:466.
2. Dang N, et al. 1990. J. Exp. Med. 172:649. - Gene ID
- 1803 View all products for this Gene ID
- UniProt
- View information about CD26 on UniProt.org
Related FAQs
Other Formats
View All CD26 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD26 | BA5b | FC |
PE anti-human CD26 | BA5b | FC |
PE/Cyanine5 anti-human CD26 | BA5b | FC |
Purified anti-human CD26 | BA5b | FC |
APC anti-human CD26 | BA5b | FC |
PE/Cyanine7 anti-human CD26 | BA5b | FC |
PerCP/Cyanine5.5 anti-human CD26 | BA5b | FC |
Biotin anti-human CD26 | BA5b | FC |
TotalSeq™-A0396 anti-human CD26 | BA5b | PG |
TotalSeq™-C0396 anti-human CD26 | BA5b | PG |
KIRAVIA Blue 520™ anti-human CD26 | BA5b | FC |
TotalSeq™-B0396 anti-human CD26 | BA5b | PG |
TotalSeq™-D0396 anti-human CD26 | BA5b | PG |
FITC anti-human CD26 | BA5b | FC |
PE anti-human CD26 | BA5b | FC |
Spark Red™ 718 anti-human CD26 (Flexi-Fluor™) | BA5b | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD26
-
PE anti-human CD26
-
PE/Cyanine5 anti-human CD26
-
Purified anti-human CD26
-
APC anti-human CD26
-
PE/Cyanine7 anti-human CD26
-
PerCP/Cyanine5.5 anti-human CD26
-
Biotin anti-human CD26
-
TotalSeq™-A0396 anti-human CD26
-
TotalSeq™-C0396 anti-human CD26
-
KIRAVIA Blue 520™ anti-human CD26
-
TotalSeq™-B0396 anti-human CD26
-
TotalSeq™-D0396 anti-human CD26
-
FITC anti-human CD26
-
PE anti-human CD26
-
Spark Red™ 718 anti-human CD26 (Flexi-Fluor™)
Follow Us