TotalSeq™-D0353 anti-human CD41 Antibody

Pricing & Availability
Clone
HIP8 (See other available formats)
Regulatory Status
RUO
Workshop
IV P38
Other Names
gpIIb, CD41a
Isotype
Mouse IgG1, κ
Barcode Sequence
ACGTTGTGGCCTTGT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
303751 10 µg 358 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD41 is a 125/25 kD α subunit of the gpIIb/IIIa (CD41/CD61) complex. CD41 is a heterodimer composed of a heavy chain (gpIIbα) and light chain (gpIIbβ) linked by a single disulfide bond. It is a member of the integrin family primarily expressed on platelets and megakaryocytes. CD41 has been reported to be involved with platelet aggregation and platelet attachment to the ECM. CD41/CD61 complex acts as the receptor for fibrinogen, fibronectin, Von Willebrand factor, and thrombin.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Capuchin Monkey, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections and blocking of platelet aggregation2. The HIP8 antibody has been reported to block the activation of platelets by various stimuli, including collagen, and ADP.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. McCarty OJT, et al. 2000. Blood 96:1789.
  3. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  4. Zhi L et al. 2013. PLoS One. 8:e79869. (IHC)
RRID
AB_2922536 (BioLegend Cat. No. 303751)

Antigen Details

Structure
Integrin family, α subunit of CD41/CD61 (GPIIb-IIIa) complex, 125/22 kD
Distribution

Platelets, megakaryocytes

Function
Platelet aggregation, platelet attachment to extracellular matrix
Ligand/Receptor
Fibrinogen, fibronectin, von Willebrand factor, thrombin
Cell Type
Megakaryocytes, Platelets
Biology Area
Cell Adhesion, Cell Biology, Immunology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Denzin L, et al. 1996. J. Exp. Med. 184:2153.
2. Denzin L, et al. 1995. Cell 82:155.
3. Riberdy J, et al. 1994. J. Cell Biol. 125:1225.

Gene ID
3674 View all products for this Gene ID
UniProt
View information about CD41 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03.24.2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD41

  • FITC anti-human CD41

  • PE anti-human CD41

  • PE/Cyanine5 anti-human CD41

  • Purified anti-human CD41

  • Pacific Blue™ anti-human CD41

  • APC/Cyanine7 anti-human CD41

  • PE/Cyanine7 anti-human CD41

  • PerCP/Cyanine5.5 anti-human CD41

  • Purified anti-human CD41 (Maxpar® Ready)

  • Alexa Fluor® 647 anti-human CD41

  • Alexa Fluor® 700 anti-human CD41

  • Alexa Fluor® 488 anti-human CD41

  • Brilliant Violet 421™ anti-human CD41

  • PE/Dazzle™ 594 anti-human CD41

  • Brilliant Violet 510™ anti-human CD41

  • Biotin anti-human CD41

  • TotalSeq™-A0353 anti-human CD41

  • TotalSeq™-C0353 anti-human CD41

  • Brilliant Violet 785™ anti-human CD41

  • Brilliant Violet 605™ anti-human CD41

  • Ultra-LEAF™ Purified anti-human CD41

  • TotalSeq™-B0353 anti-human CD41 Antibody

  • APC/Fire™ 750 anti-human CD41 Antibody

  • TotalSeq™-D0353 anti-human CD41

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account