- Clone
- RTK2071 (See other available formats)
- Regulatory Status
- RUO
- Isotype
- Rat IgG1, κ
- Barcode Sequence
- ATCAGATGCCCTCAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
400485 | 10 µg | 369 CHF |
The isotype of RTK2071 immunoglobulin is rat IgG1, κ. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.
Product DetailsProduct Details
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Trinitrophenol + KLH
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The RTK2071 immunoglobulin is useful as an isotype-matched control (for the relevant formats) for Western blotting, immunoprecipitation, immunohistochemistry, functional assay, and immunofluorescence microscopy. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 400414) as negative control1. For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 400432) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation)
Antigen Details
- Gene ID
- NA
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC Rat IgG1, κ Isotype Ctrl
-
Biotin Rat IgG1, κ Isotype Ctrl
-
FITC Rat IgG1, κ Isotype Ctrl
-
PE Rat IgG1, κ Isotype Ctrl
-
PE/Cyanine5 Rat IgG1, κ Isotype Ctrl
-
Purified Rat IgG1, κ Isotype Ctrl
-
PE/Cyanine7 Rat IgG1, κ Isotype Ctrl
-
Alexa Fluor® 647 Rat IgG1, κ Isotype Ctrl
-
Alexa Fluor® 488 Rat IgG1, κ Isotype Ctrl
-
Pacific Blue™ Rat IgG1, κ Isotype Ctrl
-
Alexa Fluor® 700 Rat IgG1, κ Isotype Ctrl
-
APC/Cyanine7 Rat IgG1, κ Isotype Ctrl
-
PerCP Rat IgG1, κ Isotype Ctrl
-
PerCP/Cyanine5.5 Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 421™ Rat IgG1, κ Isotype Ctrl
-
Ultra-LEAF™ Purified Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 605™ Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 510™ Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 650™ Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 711™ Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 785™ Rat IgG1, κ Isotype Ctrl
-
PE/Dazzle™ 594 Rat IgG1, κ Isotype Ctrl
-
Alexa Fluor® 594 Rat IgG1, κ Isotype Ctrl
-
GoInVivo™ Purified Rat IgG1, κ Isotype Ctrl
-
APC/Fire™ 750 Rat IgG1, κ Isotype Ctrl
-
TotalSeq™-A0236 Rat IgG1, κ Isotype Ctrl
-
KIRAVIA Blue 520™ Rat IgG1, κ Isotype Ctrl
-
TotalSeq™-B0236 Rat IgG1, κ Isotype Ctrl
-
TotalSeq™-C0236 Rat IgG1, κ Isotype Ctrl
-
Spark YG™ 581 Rat IgG1, κ Isotype Ctrl
-
Spark YG™ 593 Rat IgG1, κ Isotype Ctrl
-
Spark NIR™ 685 Rat IgG1, κ Isotype Ctrl
-
PE/Fire™ 640 Rat IgG1, κ Isotype Ctrl
-
TotalSeq™-D0236 Rat IgG1, κ Isotype Ctrl
-
PE/Fire™ 700 Rat IgG1, κ Isotype Ctrl
-
APC/Fire™ 810 Rat IgG1, κ Isotype Ctrl
-
Brilliant Violet 750™ Rat IgG1, κ Isotype Ctrl
-
Spark YG™ 570 Rat IgG1, κ Isotype Ctrl
-
PerCP/Fire™ 806 Rat IgG1, κ Isotype Ctrl
-
PerCP/Fire™ 780 Rat IgG1, κ Isotype Ctrl
-
Spark Red™ 718 Rat IgG1, κ Isotype Ctrl
-
TotalSeq™-Bn0236 Rat IgG1, κ Isotype Ctrl
Follow Us