TotalSeq™-D0180 anti-human CD24 Antibody

Pricing & Availability
ML5 (See other available formats)
Regulatory Status
V CD24.5
Other Names
Ly-52, Heat Stable Antigen (HSA), Nectadrin, BA-1
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
311149 10 µg 369 CHF
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD24 is a 35-45 kD glycosylphosphatidylinositol (GPI)-linked protein also known as heat stable antigen (HSA), BA-1, Ly-52, and nectadrin. It is expressed on the surface of B cells (but not plasma cells), granulocytes, follicular dendritic cells, and epithelial cells. CD24 may play a role in the regulation of B-cell proliferation and maturation. CD24 crosslinking induces a Ca2+ flux in mature B cells. CD24 has been shown to interact with CD62P (P-selectin).

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.


To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunofluorescence microscopy3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leukocyte Typing V:White Cell Differentiation Antigens. Oxford University Press. New York.
  2. McMichael A, et al. 1987. Leucocyte Typing III. Oxford University Press. New York.
  3. Yang GP, et al. 1999. Nucleic Acids Research 27:1517. (IF)
  4. Kristiansen G, et al. 2003. Clin. Cancer Res. 9:4906. (FC)
AB_2922544 (BioLegend Cat. No. 311149)

Antigen Details

GPI-linked glycoprotein, 35-45 kD

B cells, granulocytes, epithelial cells

B cell proliferation and differentiation
CD62P (P-Selectin)
Cell Type
B cells, Epithelial cells, Granulocytes
Biology Area
Molecular Family
CD Molecules
Antigen References

1. Schlossman S, et al. Eds. 1995. Leukocyte Typing V. Oxford University Press. New York.

Gene ID
100133941 View all products for this Gene ID
View information about CD24 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03.22.2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • FITC anti-human CD24

  • PE anti-human CD24

  • Purified anti-human CD24

  • Alexa Fluor® 488 anti-human CD24

  • Alexa Fluor® 647 anti-human CD24

  • PerCP/Cyanine5.5 anti-human CD24

  • APC anti-human CD24

  • PE/Cyanine7 anti-human CD24

  • Brilliant Violet 421™ anti-human CD24

  • Brilliant Violet 605™ anti-human CD24

  • PerCP anti-human CD24

  • Brilliant Violet 510™ anti-human CD24

  • Purified anti-human CD24 (Maxpar® Ready)

  • Biotin anti-human CD24

  • APC/Cyanine7 anti-human CD24

  • PE/Dazzle™ 594 anti-human CD24

  • Brilliant Violet 711™ anti-human CD24

  • PE anti-human CD24

  • TotalSeq™-A0180 anti-human CD24

  • APC/Fire™ 750 anti-human CD24

  • Brilliant Violet 785™ anti-human CD24

  • TotalSeq™-C0180 anti-human CD24

  • TotalSeq™-B0180 anti-human CD24

  • PE/Cyanine5 anti-human CD24

  • TotalSeq™-D0180 anti-human CD24

  • GMP PE anti-human CD24


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account