- Clone
- W17055E (See other available formats)
- Regulatory Status
- RUO
- Other Names
- TGFRII, TGFR2, TGFR-2, TβRII, TGFbeta-RII, TGF-Beta Receptor Type II, TGF-Beta Receptor Type-2
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- ATTTCAGGGCCGGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
399707 | 10 µg | 369 CHF |
Transforming growth factor beta receptor 2 (TGFbR2 or TGFbRII) forms a heterodimeric complex on the cell surface with TGFbR1. TGFbR2 binds TGF-beta and is important for cell proliferation, wound healing, immunosuppression, and tumorigenesis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- TGFbR2 protein (aa 1-243) expressing transfectants
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894613 (BioLegend Cat. No. 399707)
Antigen Details
- Distribution
-
B cells, T cells, monocytes, and granulocytes.
- Ligand/Receptor
- TGFbR2 forms a heterodimeric complex with TGFbR1 and binds TGF-β.
- Cell Type
- B cells, Monocytes, T cells
- Biology Area
- Immunology
- Molecular Family
- Cytokines/Chemokines
- Antigen References
-
- Horbelt D, et al. 2010. J Cell Sci. 123:4340-50.
- Wei CY, et al. 2015. Int J Clin Exp Pathol. 8:14619-29.
- Numata S, et al. 2008. J Psychiatr Res. 42:425-32.
- Gene ID
- 7048 View all products for this Gene ID
- Specificity (DOES NOT SHOW ON TDS):
- TGF-beta Receptor II
- Specificity Alt (DOES NOT SHOW ON TDS):
- TGF-β Receptor II
- App Abbreviation (DOES NOT SHOW ON TDS):
- PG
- UniProt
- View information about TGF-beta Receptor II on UniProt.org
Related FAQs
Other Formats
View All TGF-β Receptor II Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human TGF-β Receptor II | W17055E | FC |
PE anti-human TGF-β Receptor II | W17055E | FC |
APC anti-human TGF-β Receptor II | W17055E | FC |
TotalSeq™-D1171 anti-human TGF-β Receptor II | W17055E | PG |
Brilliant Violet™ 421 anti-human TGF-β Receptor II | W17055E | FC |
PE/Dazzle™ 594 anti-human TGF-β Receptor II | W17055E | FC |
PE/Cyanine7 anti-human TGF-β Receptor II | W17055E | FC |
TotalSeq™-A1171 anti-human TGF-β Receptor II | W17055E | PG |
TotalSeq™-C1171 anti-human TGF-β Receptor II | W17055E | PG |
TotalSeq™-B1171 anti-human TGF-β Receptor II | W17055E | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human TGF-β Receptor II
-
PE anti-human TGF-β Receptor II
-
APC anti-human TGF-β Receptor II
-
TotalSeq™-D1171 anti-human TGF-β Receptor II
-
Brilliant Violet™ 421 anti-human TGF-β Receptor II
-
PE/Dazzle™ 594 anti-human TGF-β Receptor II
-
PE/Cyanine7 anti-human TGF-β Receptor II
-
TotalSeq™-A1171 anti-human TGF-β Receptor II
-
TotalSeq™-C1171 anti-human TGF-β Receptor II
-
TotalSeq™-B1171 anti-human TGF-β Receptor II
Follow Us