- Clone
- UV4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- IL-6R1, gp80, IL-6 receptor alpha, IL-6R
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGATGGGAGCTTATC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
352819 | 10 µg | 296€ |
CD126 is an 80 kD IL-6 receptor α chain also known as IL-6R. It is a member of the immunoglobulin superfamily that is expressed on plasma cells, T cells, activated B cells, monocytes, granulocytes, hepatocytes, epithelial cells, and fibroblasts. Functional IL-6 receptors are formed by the non-covalent association of CD126 and the IL-6 receptor β chain (CD130 or gp130). CD126 binds IL-6 with low affinity but does not signal. The β chain (gp130, CD130) does not bind IL-6 by itself but associates with the α-chain/IL-6 complex to initiate signal transduction. IL-6 binding to the receptor complex results in the stimulation of B and T cells, and hematopoietic precursor proliferation and differentiation. A soluble form of CD126 has been found in human serum.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human myeloma cell line U266
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: blocking of IL-6 binding to IL-6R.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Huang YW and Vitetta ES. 1993. Hybridoma 12:621.
- RRID
-
AB_2894593 (BioLegend Cat. No. 352819)
Antigen Details
- Structure
- Ig superfamily, associates with IL-6Rβ chain (CD130, gp130), 80 kD
- Distribution
-
Plasma cells, T cells, monocytes, hepatocytes, activated B cells, granulocytes, epithelial cells, and fibroblasts
- Function
- Stimulates T cells, B cells, and hematopoietic precursor proliferation and differentiation
- Interaction
- CD130, c-Src, STAT3, WWP1, WWP2
- Ligand/Receptor
- IL-6
- Cell Type
- B cells, Epithelial cells, Fibroblasts, Granulocytes, Monocytes, Plasma cells, T cells
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience, Signal Transduction
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Taga T, et al. 1997. Annu. Rev. Immunol. 15:797.
2. Fitzgerald K, et al. 2001. The Cytokine FactsBook. Academic Press London.
3. Boulanger MJ, et al. 2003. Science 300:2101.
4. Gaillard JP, et al. 1993. Eur. J. Immunol. 23:820. - Gene ID
- 3570 View all products for this Gene ID
- Specificity (DOES NOT SHOW ON TDS):
- CD126
- Specificity Alt (DOES NOT SHOW ON TDS):
- CD126
- App Abbreviation (DOES NOT SHOW ON TDS):
- PG
- UniProt
- View information about CD126 on UniProt.org
Related FAQs
Other Formats
View All CD126 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD126 (IL-6Rα) | UV4 | FC |
PE anti-human CD126 (IL-6Rα) | UV4 | FC |
Biotin anti-human CD126 (IL-6Rα) | UV4 | FC |
Purified anti-human CD126 (IL-6Rα) | UV4 | FC |
PerCP/Cyanine5.5 anti-human CD126 (IL-6Rα) | UV4 | FC |
PE/Cyanine7 anti-human CD126 (IL-6Rα) | UV4 | FC |
TotalSeq™-A0819 anti-human CD126 (IL-6Rα) | UV4 | PG |
TotalSeq™-C0819 anti-human CD126 (IL-6Rα) | UV4 | PG |
TotalSeq™-B0819 anti-human CD126 (IL-6Rα) Antibody | UV4 | PG |
TotalSeq™-D0819 anti-human CD126 (IL-6Rα) Antibody | UV4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD126 (IL-6Rα)
-
PE anti-human CD126 (IL-6Rα)
-
Biotin anti-human CD126 (IL-6Rα)
-
Purified anti-human CD126 (IL-6Rα)
-
PerCP/Cyanine5.5 anti-human CD126 (IL-6Rα)
-
PE/Cyanine7 anti-human CD126 (IL-6Rα)
-
TotalSeq™-A0819 anti-human CD126 (IL-6Rα)
-
TotalSeq™-C0819 anti-human CD126 (IL-6Rα)
-
TotalSeq™-B0819 anti-human CD126 (IL-6Rα) Antibody
-
TotalSeq™-D0819 anti-human CD126 (IL-6Rα) Antibody
Follow Us