TotalSeq™-D0170 anti-human CD272 (BTLA) Antibody

Pricing & Availability
Clone
MIH26 (See other available formats)
Regulatory Status
RUO
Other Names
BTLA, B and T lymphocyte attenuator
Isotype
Mouse IgG2a, κ
Barcode Sequence
GTTATTGGACTAAGG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
344535 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

B and T lymphocyte attenuator (BTLA) is an Ig superfamily coinhibitory receptor with structural similarity to programmed cell death 1 (PD-1) and CTLA-4. BTLA is expressed on B cells, T cells, macrophages, dendritic cells, NKT cells, and NK cells. Engagement of BTLA by its ligand Herpes Virus Entry Mediator (HVEM) is critical for negatively regulating immune response. The absence of BTLA with HVEM inhibitory interactions leads to increased experimental autoimmune encephalomyelitis severity, enhanced rejection of partially mismatched allografts, an increased CD8+ memory T cell population, increased severity of colitis, and reduced effectiveness of T regulatory cells. BTLA plays an important role in the induction of peripheral tolerance of both CD4+ and CD8+ T cells in vivo. Tolerant T cells have significant up-regulated expression of BTLA compared with effector and naïve T cells. BTLA may cooperate with CTLA-4 and PD-1 to control T cell tolerance and autoimmunity. It has been reported that BTLA may regulate T cell function through binding to B7-H4.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human BTLA transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: inhibition of T cell proliferation and cytokine production1. Clone MIH26 has agonistic activity on BTLA, resulting in the inhibition of activation.

The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for use in in vitro and in vivo biofunctional assays.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Otsuki N, et al. 2006. Biochem. Bioph. Res. Co. 344:1121.
  2. Okano M, et al. 2008. Clin. Exp. Allergy 38:1891.
RRID
AB_2894681 (BioLegend Cat. No. 344535)

Antigen Details

Structure
Ig superfamily, with similar structure to CTLA-4 and PD-1
Distribution

B cells and T lymphocytes, NK cells and dendritic cells

Function
Negative regulation of T cell activation, proliferation and cytokine production
Ligand/Receptor
HVEM
Cell Type
B cells, Dendritic cells, NK cells, T cells, Tregs
Biology Area
Immunology, Inhibitory Molecules
Molecular Family
CD Molecules
Antigen References

1. Watanabe N, et al. 2003. Nat. Immunol. 4:670.
2. Sun Y, et al. 2009. J. Immunol. 183:1946.
3. Gonzalez LC, et al. 2005. P. Natl. Acad. Sci. USA 102:1116.

Gene ID
151888 View all products for this Gene ID
UniProt
View information about CD272 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 07.21.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD272 (BTLA)

  • PE anti-human CD272 (BTLA)

  • APC anti-human CD272 (BTLA)

  • Brilliant Violet 421™ anti-human CD272 (BTLA)

  • PerCP/Cyanine5.5 anti-human CD272 (BTLA)

  • APC/Cyanine7 anti-human CD272 (BTLA)

  • PE/Cyanine7 anti-human CD272 (BTLA)

  • Alexa Fluor® 647 anti-human CD272 (BTLA)

  • PE/Dazzle™ 594 anti-human CD272 (BTLA)

  • FITC anti-human CD272 (BTLA)

  • TotalSeq™-A0170 anti-human CD272 (BTLA)

  • TotalSeq™-C0170 anti-human CD272 (BTLA)

  • Ultra-LEAF™ Purified anti-human CD272 (BTLA)

  • PE/Cyanine5 anti-human CD272 (BTLA)

  • TotalSeq™-B0170 anti-human CD272 (BTLA)

  • TotalSeq™-D0170 anti-human CD272 (BTLA)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account