TotalSeq™-D0366 anti-human CD184 (CXCR4) Antibody

Pricing & Availability
Clone
12G5 (See other available formats)
Regulatory Status
RUO
Workshop
VII 70204
Other Names
CXCR4, Fusin
Isotype
Mouse IgG2a, κ
Barcode Sequence
TCAGGTCCTTTCAAC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
306543 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD184, also known as fusin or CXCR4, is a 45 kD seven transmembrane G-protein-linked CXC chemokine receptor. CD184 is widely expressed on blood and tissue cells, including B and T cells, monocytes, macrophages, dendritic cells, granulocytes, megakaryocytes/platelets, lymphoid, myeloid precursor cells, endothelial cells, epithelial cells, astrocytes, and neurons, among other tissue cells. CD184 is the receptor for CXC chemokine SDF-1, mediates blood cell migration, and is involved in B lymphopoiesis and myelopoiesis, cardiogenesis, blood vessel formation, and cerebellar development. CXCR4 is also a coreceptor of X4 HIV-1 and an alternative receptor for some isolates of HIV-2.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Chimpanzee, Sooty Mangabey
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
CP-MAC-infected Sup-T1 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections11, immunocytochemistry3, immunofluorescence microscopy2,6, and blocking of CD4-independent infection by HIV-2 and CD4-dependent infection by some T cell-tropic isolates of HIV-14,5. Clone 12G5 may not be suitable for Western blotting.10 The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 306539 & 306540).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. McKnight A, et al. 1997. J. Virol. 71:1692.
  2. Endres MJ, et al. 1996. Cell 87:745. (Immunogen, IF)
  3. Volin MV, et al. 1998. Biochem. Biophys. Res. Commun. 242:46. (ICC)
  4. Berndt C, et al. 1998. P. Natl. Acad. Sci. USA 95:12556. (Block)
  5. Ullrich CK, et al. 2000. Blood 96:1438. (Block)
  6. Murga M, et al. 2005. Blood 105:1992. (IF)
  7. Thompson BD. 2007. J. Biol. Chem. 282:9547. (FC) PubMed
  8. Isnardi I, et al. 2010. Blood 115:5026. PubMed
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  10. Fischer T, et al. 2008. PLoS One 3:e4069.
  11. Schmid BC, et al. 2004. Breast Cancer Res. Treat. 84:247. (IHC)
RRID
AB_2936571 (BioLegend Cat. No. 306543)

Antigen Details

Structure
Rhodopsin family, G-protein linked seven transmembrane glycoprotein, 45 kD
Distribution

T cells and B cells, dendritic cells, monocytes, granulocytes, hematopoietic progenitors, endothelial cells

Function
B lymphopoiesis and myelopoiesis, cardiogenesis, blood vessel formation, cerebellar development
Ligand/Receptor
SDF-1 receptor, coreceptor for X4 HIV-1
Cell Type
B cells, Dendritic cells, Endothelial cells, Granulocytes, Hematopoietic stem and progenitors, Mesenchymal Stem Cells, Monocytes, Neural Stem Cells, T cells, Tregs
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Berger E, et al. 1999. Annu. Rev. Immunol. 17:657.
2. Loetscher P, et al. 2000. Adv. Immunol. 74:127.
3. Murphy P, et al. 2000. Pharmacol. Rev. 52:145.

Gene ID
7852 View all products for this Gene ID
UniProt
View information about CD184 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Go To Top Version: 1    Revision Date: 01-17-2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account