TotalSeq™-D0355 anti-human CD137 (4-1BB) Antibody

Pricing & Availability
Clone
4B4-1 (See other available formats)
Regulatory Status
RUO
Workshop
VI C-7
Other Names
4-1BB, ILA, CD137, TNFRSF9
Isotype
Mouse IgG1, κ
Barcode Sequence
CAGTAAGTTCGGGAC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
309845 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD137 is a 39 kD transmembrane protein also known as 4-1BB. It is expressed on activated T cells. CD137 is a type I membrane protein and a member of the tumor necrosis factor receptor superfamily. CD137 appears to be important for T cell proliferation and survival, and induces monocyte activation through its interaction with 4-1BB ligand.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Ectodomain of recombinant human 4-1BB fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation1,4, inhibition of cytokine production2,3, and ELISA. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 309804) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by Streptavidin-PE (Cat. No. 405204)).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Garni-Wagner B, et al. 1996. Cell. Immunol. 169:91. (IP)
  2. Salih HR, et al. 2000. J. Immunol. 165:2903. (FA)
  3. Kienzle G, et al. 2000. Int. Immunol. 12:73. (FA)
  4. Langstein J, et al. 1998. J. Immunol. 160:2488. (IP)
RRID
AB_2894598 (BioLegend Cat. No. 309845)

Antigen Details

Structure
TNFR superfamily, type I transmembrane protein, 30 kD
Distribution

Activated T cells

Function
T cell costimulation
Ligand/Receptor
4-1BB ligand
Cell Type
T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Gruss H, et al. 1995. Blood 85:3378.
2. Sica G, et al. 2000. Adv. Exp. Med. Biol. 465:355.
3. Alderson M, et al. 1994. Eur. J. Immunol. 24:2219.
4. Schwarz H, et al. 1996. Blood 87:2839.

Gene ID
3604 View all products for this Gene ID
UniProt
View information about CD137 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08-12-2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD137 (4-1BB)

  • PE anti-human CD137 (4-1BB)

  • Biotin anti-human CD137 (4-1BB)

  • PE/Cyanine5 anti-human CD137 (4-1BB)

  • APC anti-human CD137 (4-1BB)

  • PerCP/Cyanine5.5 anti-human CD137 (4-1BB)

  • Alexa Fluor® 700 anti-human CD137 (4-1BB)

  • PE/Cyanine7 anti-human CD137 (4-1BB)

  • Brilliant Violet 421™ anti-human CD137 (4-1BB)

  • APC/Cyanine7 anti-human CD137 (4-1BB)

  • Brilliant Violet 605™ anti-human CD137 (4-1BB)

  • Alexa Fluor® 647 anti-human CD137 (4-1BB)

  • PE/Dazzle™ 594 anti-human CD137 (4-1BB)

  • Brilliant Violet 650™ anti-human CD137 (4-1BB)

  • Brilliant Violet 711™ anti-human CD137 (4-1BB)

  • APC/Fire™ 750 anti-human CD137 (4-1BB)

  • TotalSeq™-A0355 anti-human CD137 (4-1BB)

  • TotalSeq™-B0355 anti-human CD137 (4-1BB)

  • TotalSeq™-C0355 anti-human CD137 (4-1BB)

  • Ultra-LEAF™ Purified anti-human CD137 (4-1BB)

  • Brilliant Violet 750™ anti-human CD137 (4-1BB)

  • TotalSeq™-D0355 anti-human CD137 (4-1BB)

  • PerCP/Fire™ 806 anti-human CD137 (4-1BB)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account