- Clone
- AD2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V B-CD73.3
- Other Names
- Ecto-5'-nucleotidase, E.C3.1.3.5, L-VAP-2, NT5E, 5'-NT
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CAGTTCCTCAGTTCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD73 is a 70 kD glycophosphatidylinositol (GPI)-linked 5'-nucleotidase, which is also known as ecto-5'-nucleotidase. It converts adenosine monophosphate (AMP) to adenosine. CD73 is expressed on subsets of T and B cells, mesenchymal stem cells, follicular dendritic cells, endothelial cells, and epithelial cells. It has been reported that CD73 costimulates T cell activation, and mediates adhesion of lymphocytes to follicular dendritic cells and endothelial cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include:immunofluorescence3.
Clone AD2 has been noted to induce clustering and internalization of CD73 in vivo and inhibit metastasis in a murine breast cancer xenograft model4. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Nakamura T, et al. 1993. J. Immunol. 151:6933.
- Liao J, et al. 2011. J Endod. 37:1217. PubMed
- Touboul C, et al. 2013. J. Transl. Med. 11:28. (IF)
- Terp MG, et al. 2013. J Immunol. 191: 4165-73 (Block)
- RRID
-
AB_2894606 (BioLegend Cat. No. 344037)
Antigen Details
- Structure
- GPI-linked 5'-nucleotidase, 70 kD
- Distribution
-
Subsets of T cells and B cells, mesenchymal stem cells, follicular dendritic cells, endothelial cells, and epithelial cells
- Function
- Catalyses dephosphorylation of adenosine monophosphate, costimulates T cell activation, mediates adhesion of lymphocytes to follicular dendritic cells and endothelial cells
- Cell Type
- B cells, Dendritic cells, Endothelial cells, Epithelial cells, Mesenchymal Stem Cells, T cells, Tregs
- Biology Area
- Costimulatory Molecules, Immunology, Stem Cells
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Zola H, et al. 2007. Leukocyte and stromal Cell Molecules:the CD Markers. A John Wiley & Sons Inc, Publication.
2. Airas L and Jalkanen S, et al. 1996. Blood 88:1755.
3. Gutensohn W, et al. 1995. Cell Immunol. 161:213.
4. Airas L, et al. 1995. J. Exp. Med. 182:1603. - Gene ID
- 4907 View all products for this Gene ID
- UniProt
- View information about CD73 on UniProt.org
Related FAQs
Other Formats
View All CD73 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD73 (Ecto-5'-nucleotidase)
-
Brilliant Violet 421™ anti-human CD73 (Ecto-5'-nucleotidase)
-
Purified anti-human CD73 (Ecto-5'-nucleotidase)
-
PE anti-human CD73 (Ecto-5'-nucleotidase)
-
APC anti-human CD73 (Ecto-5'-nucleotidase)
-
PE/Cyanine7 anti-human CD73 (Ecto-5'-nucleotidase)
-
Pacific Blue™ anti-human CD73 (Ecto-5'-nucleotidase)
-
PerCP/Cyanine5.5 anti-human CD73 (Ecto-5'-nucleotidase)
-
Biotin anti-human CD73 (Ecto-5'-nucleotidase)
-
PE/Dazzle™ 594 anti-human CD73 (Ecto-5'-nucleotidase)
-
APC/Cyanine7 anti-human CD73 (Ecto-5'-nucleotidase)
-
Brilliant Violet 605™ anti-human CD73 (Ecto-5'-nucleotidase)
-
Brilliant Violet 711™ anti-human CD73 (Ecto-5'-nucleotidase)
-
Brilliant Violet 785™ anti-human CD73 (Ecto-5'-nucleotidase)
-
TotalSeq™-A0577 anti-human CD73 (Ecto-5'-nucleotidase)
-
TotalSeq™-C0577 anti-human CD73 (Ecto-5'-nucleotidase)
-
TotalSeq™-B0577 anti-human CD73 (Ecto-5'-nucleotidase)
-
APC/Fire™ 750 anti-human CD73 (Ecto-5'-nucleotidase)
-
TotalSeq™-D0577 anti-human CD73 (Ecto-5'-nucleotidase)
-
Alexa Fluor® 700 anti-human CD73 (Ecto-5'-nucleotidase)
-
Alexa Fluor® 647 anti-human CD73 (Ecto-5'-nucleotidase)
-
Brilliant Violet 510™ anti-human CD73 (Ecto-5'-nucleotidase)
-
PerCP/Fire™ 780 anti-human CD73 (Ecto-5'-nucleotidase)
-
Spark Red™ 718 anti-hu CD73 (Ecto-5'-nucleotidase) (Flexi-Fluor™)
Follow Us