- Clone
- GHI/61 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI M38
- Other Names
- GHI/61, M130, RM3/1, p155, Hemoglobin/Haptoglobin Complex Receptor, macrophage-associated antigen, ED2(rat)
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCTTCTCCTTCCTTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD163 is a member of the group B scavenger receptor cysteine-rich superfamily, also known as GHI/61, M130, RM3/1, p155, hemoglobin-haptoglobin complex receptor, or macrophage-associated antigen. It is a 134 kD (non-reduced)/155 kD (reduced) glycoprotein primarily expressed on macrophages, Kupffer cells, monocytes, a subset of dendritic cells, and a subset of hematopoietic stem/progenitor cells. CD163 binds to haptoglobin-hemoglobin complex and TWEAK, and plays a role in clearing hemoglobin and regulating cytokine production by macrophages. Membrane CD163 can be cleaved by metalloproteinases (MMP), resulting in a soluble form. Elevated serum level of sCD163 has been implicated in many kinds of inflammatory diseases.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone GHI/61 binds to domain 7 of CD163. Additional reported applications (for the relevant formats) include: immunocytochemical staining, immunoprecipitation, western blot1, and spatial biology (IBEX)6,7.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Pulford K, et al. 1992. Immunology 75:588. (ICC, IP, WB)
- Law SK, et al. 1993. Eur. J. Immunol. 23:2320.
- Madsen M, et al. 2004. J. Biol. Chem. 279:51561.
- Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
- Buttari B, et al. 2011. Atherosclerosis. 215:316. PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2904357 (BioLegend Cat. No. 333641)
Antigen Details
- Structure
- 134 kD (non-reduced)/155 kD (reduced) glycoprotein, scavenger receptor superfamily
- Distribution
-
Monocytes, macrophages, Kuffer cells, subset of dendritic cells, subset of hematopoietic stem/progenitor cells
- Function
- Clearance of haptoglobin-hemoglobin complex, regulation of cytokine production by macrophages
- Ligand/Receptor
- Haptoglobin-hemoglobin complex, TWEAK
- Cell Type
- Dendritic cells, Hematopoietic stem and progenitors, Macrophages, Monocytes
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
1. Roth J, et al. 1994 Transolantation. 57:127
2. Van den Heuvel MM, et al.1999 J. Leukoc. Biol. 66:858
3. Sulahian TH, et al. 2000 Cytokines 12:1312
4. Fabriek BO, et al. 2007 J. Neuroimmunol. 187:179 - Gene ID
- 9332 View all products for this Gene ID
- UniProt
- View information about CD163 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD163 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PerCP anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
Purified anti-human CD163
Human peripheral blood monocytes stained with purified GHI/6... -
Biotin anti-human CD163
Human peripheral blood monocytes stained with biotinylated G... -
PE anti-human CD163
Human peripheral blood monocytes stained with GHI/61 PE -
PerCP/Cyanine5.5 anti-human CD163
Human peripheral blood lymphocytes, monocytes, granulocytes ... -
APC anti-human CD163
Human peripheral blood monocytes stained with GHI/61 APC -
Brilliant Violet 421™ anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
PE/Cyanine7 anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
Brilliant Violet 605™ anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
FITC anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
Alexa Fluor® 647 anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... Confocal image of human lymph node sample acquired using the... -
APC/Cyanine7 anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
PE/Dazzle™ 594 anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
Brilliant Violet 510™ anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
Brilliant Violet 711™ anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
Brilliant Violet 785™ anti-human CD163
Human peripheral blood monocytes were stained with CD163 (cl... -
APC/Fire™ 750 anti-human CD163
Human lysed whole blood was stained with CD163 (clone GHI/61... -
TotalSeq™-A0358 anti-human CD163
-
TotalSeq™-C0358 anti-human CD163
-
TotalSeq™-B0358 anti-human CD163
-
PE/Cyanine5 anti-human CD163
Human peripheral blood monocytes were stained with anti-huma... -
TotalSeq™-D0358 anti-human CD163
-
Alexa Fluor® 700 anti-human CD163
Human peripheral blood monocytes were stained with anti-huma... -
Brilliant Violet 650™ anti-human CD163
Human peripheral blood cells were stained with anti-human CD...
Follow Us