TotalSeq™-D0218 anti-human CD62P (P-Selectin) Antibody

Pricing & Availability
Clone
AK4 (See other available formats)
Regulatory Status
RUO
Workshop
VI P-44
Other Names
GMP-140, PADGEM
Isotype
Mouse IgG1, κ
Barcode Sequence
CCTTCCGTATCCCTT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
304951 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD62P is a 140 kD type I transmembrane glycoprotein also known as P-selectin, platelet activation-dependent granule membrane protein (PADGEM), and GMP-140. It is expressed on activated platelets, megakaryocytes, and endothelial cells. CD62P is primarily stored in secretory α-granules in platelets and Weibel-Palade bodies in endothelial cells, and is rapidly relocated to the plasma membrane upon activation. The ligands for CD62P are CD162 and CD24. A primary function of CD62P is cell adhesion during neutrophil rolling, and platelet-neutrophil and platelet-monocyte interactions.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections4 and in vitro blocking of adhesion of platelets1. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 304947 & 304948).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Skinner M, et al. 1991. J. Biol. Chem. 266:5371. (Block)
  2. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
  3. Yen YT, et al. 2006. J. Virol. 80:2684.
  4. Sato Y, et al. 2005. Blood 106:428. (IHC)
RRID
AB_2892359 (BioLegend Cat. No. 304951)

Antigen Details

Structure
Selectin, type I glycoprotein, 140 kD
Distribution

Activated platelets, megakaryocytes, endothelial cells

Function
Adhesion, neutrophil rolling, platelet-neutrophil and platelet-monocyte interactions
Ligand/Receptor
CD162 (PSGL-1), CD24 and sialylated Lewis X
Cell Type
Endothelial cells, Megakaryocytes, Neutrophils, Platelets
Biology Area
Cell Adhesion, Cell Biology, Immunology, Neuroscience, Synaptic Biology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. McEver R, et al. 1995. J. Biol. Chem. 270:11025.
2. Varki A. 1994. P. Natl. Acad. Sci. USA 91:7390.

Gene ID
6403 View all products for this Gene ID
UniProt
View information about CD62P on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD62P Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD62P (P-Selectin) AK4 FC
FITC anti-human CD62P (P-Selectin) AK4 FC
PE anti-human CD62P (P-Selectin) AK4 FC
PE/Cyanine5 anti-human CD62P (P-Selectin) AK4 FC
Purified anti-human CD62P (P-Selectin) AK4 FC,IHC-F
Biotin anti-human CD62P (P-Selectin) AK4 FC
Alexa Fluor® 488 anti-human CD62P (P-Selectin) AK4 FC
Alexa Fluor® 647 anti-human CD62P (P-Selectin) AK4 FC
Brilliant Violet 605™ anti-human CD62P (P-Selectin) AK4 FC
Brilliant Violet 421™ anti-human CD62P (P-Selectin) AK4 FC
PE/Cyanine7 anti-human CD62P (P-Selectin) AK4 FC
PerCP/Cyanine5.5 anti-human CD62P (P-Selectin) AK4 FC
Alexa Fluor® 700 anti-human CD62P (P-Selectin) AK4 FC
PE/Dazzle™ 594 anti-human CD62P (P-Selectin) AK4 FC
APC/Fire™ 750 anti-human CD62P (P-Selectin) AK4 FC
TotalSeq™-A0218 anti-human CD62P (P-Selectin) AK4 PG
Brilliant Violet 650™ anti-human CD62P (P-Selectin) AK4 FC
Brilliant Violet 510™ anti-human CD62P (P-Selectin) AK4 FC
Brilliant Violet 711™ anti-human CD62P (P-Selectin) AK4 FC
APC/Cyanine7 anti-human CD62P (P-Selectin) AK4 FC
Brilliant Violet 785™ anti-human CD62P (P-Selectin) AK4 FC
TotalSeq™-C0218 anti-human CD62P (P-Selectin) AK4 PG
Ultra-LEAF™ Purified anti-human CD62P (P-Selectin) AK4 FC
TotalSeq™-B0218 anti-human CD62P (P-Selectin) Antibody AK4 PG
TotalSeq™-D0218 anti-human CD62P (P-Selectin) AK4 PG
PE anti-human CD62P AK4 FC
FITC anti-human CD62P AK4 FC
GMP FITC anti-human CD62P (P-Selectin) AK4 FC
GMP PE anti-human CD62P (P-Selectin) AK4 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account