TotalSeq™-D0593 anti-human CD203c (E-NPP3) Antibody

Product Details

Verified Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

HEK-293 cells transfected with human E-NPP3

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

1. Bühring HJ, et al. 1999. Blood 94:2343.
2. Bühring HJ, et al. 2001. Blood 97:3303.
3. Platz IJ, et al. 2001. Int. Arch. Allergy Immunol. 126:335.
4. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
5. Gernez Y, et al. 2011. Int. Arch. Allergy Immunol. 154:318. (FC) PubMed

RRID

AB_2904345 (BioLegend Cat. No. 324631)

Antigen Details

Structure

Transmembrane ectoenzyme family member involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity); reduced molecular weight is 130 and 150 kD, unreduced is 270 kD

Distribution

Basophils and mast cells, highly expressed on activated basophils; secretory glands in endometrium and glioma cells are also positive

Function

Multifunctional ectoenzyme involved in the clearance of extracellular nucleotides

Ligand/Receptor

Substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD

Cell Type

Basophils, Mast cells

Biology Area

Immunology

Molecular Family

CD Molecules

Antigen References

1. Yano Y, et al. 2003. Int. J. Mol. Med. 12:763-6.
2. Andoh K, et al. 1999. Biochim. Biophys. Acta. 1446:213-24.

Gene ID

5169 View all products for this Gene ID

UniProt

View information about CD203c on UniProt.org

Documentation

• Technical Data Sheet (pdf)
• Certificate of Analysis
• Material Safety Data Sheet

Reviews

Related Protocols

• TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Pages & Pathways

Related FAQs

Other Formats

Concentration & Expiration Lookup

Certificate of Analysis