Loading...

TotalSeq™-D0447 anti-human CD200 (OX2) Antibody

Pricing & Availability
Clone
OX-104 (See other available formats)
Regulatory Status
RUO
Workshop
VII 70655
Other Names
OX-2, OX2
Isotype
Mouse IgG1, κ
Barcode Sequence
CACGTAGACCTTTGC
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
329231 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD200, also known as OX2, is a member of the immunoglobulin superfamily (IgSF). It is a monomorphic cell surface glycoprotein that is expressed on thymocytes, neurons, endothelium, follicular dendritic cells in all lymphoid organs, a subset of CD34+ progenitor cells, and at low levels on some smooth muscle and B lymphocytes. It is not expressed on NK cells, monocytes, granulocytes, or platelets. CD200 costimulates T cell proliferation. It may regulate myeloid cell activity in a variety of tissues. The interaction between CD200 (OX2) and CD200 receptor (OX2R) system is of importance in the control of macrophage and granulocyte activation, which may contribute to pathways that suppress and limit macrophage induced inflammatory damage in tissue.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemistry of formalin-fixed paraffin-embedded sections1 and acetone-fixed frozen sections2, and blocking of CD200 interaction with CD200R.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Patel GK, et al. 2012. J. Invest. Dermatol. 132:401. (IHC)
  2. Wright GJ, et al. 2001. Immunology 102:173. (IHC)
  3. Foster-Cuevas M, et al. 2004. J. Virol. 78:7667. (FC)
RRID
AB_2892395 (BioLegend Cat. No. 329231)

Antigen Details

Structure
Immunoglobulin superfamily
Distribution

T cells, neurons, endothelium

Function
Costimulates T cell proliferation
Receptors
CD200R
Cell Type
Endothelial cells, Neurons, T cells
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Wright GJ, et al. 2001. Immunol. 102:173.
2. Foster-Cuevas M, et al. 2004. J. Virol. 78:7667.
3. Mason D, et al. 2002. ed. Leukocyte Typing VII. New York:Oxford Univ. Press.
4. Broderick C, et al. 2002. Am. J. Pathol. 161:1669.

Regulation
Induces a downregulation of macrophage activity
Gene ID
4345 View all products for this Gene ID
UniProt
View information about CD200 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/25/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD200 (OX2)

  • Biotin anti-human CD200 (OX2)

  • PE anti-human CD200 (OX2)

  • APC anti-human CD200 (OX2)

  • Brilliant Violet 421™ anti-human CD200 (OX2)

  • PE/Cyanine7 anti-human CD200 (OX2)

  • Alexa Fluor® 647 anti-human CD200 (OX2)

  • PerCP/Cyanine5.5 anti-human CD200 (OX2)

  • Brilliant Violet 605™ anti-human CD200 (OX2)

  • Purified anti-human CD200 (OX2) (Maxpar® Ready)

  • APC/Cyanine7 anti-human CD200 (OX2)

  • Brilliant Violet 711™ anti-human CD200 (OX2)

  • APC/Fire™ 750 anti-human CD200 (OX2)

  • Ultra-LEAF™ Purified anti-human CD200 (OX2)

  • TotalSeq™-C0447 anti-human CD200 (OX2)

  • TotalSeq™-D0447 anti-human CD200 (OX2)

  • TotalSeq™-A0447 anti-human CD200 (OX2)

  • TotalSeq™-B0447 anti-human CD200 (OX2)

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account