- Clone
- F38-2E2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- T cell immunoglobulin and mucin domain containing protein 3, hepatitis virus cellular receptor 2, CD366
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGTCCTACCCAACTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
345057 | 10 µg | 296€ |
CD366 (Tim-3) is a transmembrane protein also known as T cell immunoglobulin and mucin domain containing protein-3. Tim-3 is expressed at high levels on activated T cells (preferentially on Th1 cells, monocytes/macrophages, and dendritic cells). Tim-3 has also been shown to exist as a soluble protein. Cells expressing Tim-3 are present at high levels in the CNS of animals at the onset of experimental autoimmune encephalomyelitis (EAE), a disease mediated by lymphocytes secreting Th1-like cytokines. Tim-3 has been proposed to inhibit Th1-mediated immune responses and promote immunological tolerance.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human Tim-3 fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for relevant formats of this clone) include: costimulation1 (clone 2E2 has been shown to enhance T-cell receptor mediated activation and cytokine secretion) and blocking2,3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Hastings WD, et al. 2009. Eur. J. Immunol. 39:2492. (Costim)
- Jones RB, et al. 2008. J. Exp. Med. 205:2763. (Block)
- Klibi J, et al 2009. Blood 113:1957. (FC, Block)
- RRID
-
AB_2892421 (BioLegend Cat. No. 345057)
Antigen Details
- Structure
- Transmembrane protein containing immunoglobulin domain and mucin-like domain; can exist as a soluble form lacking mucin and transmembrane domains
- Distribution
-
Activated T cells, preferentially on Th1 cells, monocytes, dendritic cells
- Function
- Plays a role in regulating macrophage activation, T cell apoptosis and immune tolerance
- Ligand/Receptor
- Galectin-9
- Cell Type
- Dendritic cells, Monocytes, T cells, Th1, Tregs
- Biology Area
- Immunology, Inhibitory Molecules
- Molecular Family
- CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Hafler DA and Kuchroo V. 2008. J. Exp. Med. 205:2699.
2. Zhu C, et al. 2005. Nat. Immunol. 6:1245.
3. Wang F, et al. 2009. Immunobiology 214:342. - Gene ID
- 84868 View all products for this Gene ID
- UniProt
- View information about CD366 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD366 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD366 (Tim-3)
-
PE anti-human CD366 (Tim-3)
-
Brilliant Violet 421™ anti-human CD366 (Tim-3)
-
Ultra-LEAF™ Purified anti-human CD366 (Tim-3)
-
APC anti-human CD366 (Tim-3)
-
PE/Cyanine7 anti-human CD366 (Tim-3)
-
PerCP/Cyanine5.5 anti-human CD366 (Tim-3)
-
Brilliant Violet 605™ anti-human CD366 (Tim-3)
-
FITC anti-human CD366 (Tim-3)
-
Purified anti-human CD366 (Tim-3) (Maxpar® Ready)
-
Brilliant Violet 711™ anti-human CD366 (Tim-3)
-
APC/Cyanine7 anti-human CD366 (Tim-3)
-
Brilliant Violet 785™ anti-human CD366 (Tim-3)
-
Brilliant Violet 650™ anti-human CD366 (Tim-3)
-
Brilliant Violet 510™ anti-human CD366 (Tim-3)
-
PE/Dazzle™ 594 anti-human CD366 (Tim-3)
-
GoInVivo™ Purified anti-human CD366 (Tim-3)
-
APC/Fire™ 750 anti-human CD366 (Tim-3)
-
Pacific Blue™ anti-human CD366 (Tim-3)
-
Biotin anti-human CD366 (Tim-3)
-
TotalSeq™-A0169 anti-human CD366 (Tim-3)
-
TotalSeq™-C0169 anti-human CD366 (Tim-3)
-
PE/Cyanine5 anti-human CD366 (Tim-3)
-
TotalSeq™-B0169 anti-human CD366 (Tim-3)
-
Brilliant Violet 750™ anti-human CD366 (Tim-3) Antibody
-
TotalSeq™-D0169 anti-human CD366 (Tim-3)
-
PE/Fire™ 810 anti-human CD366 (Tim-3)
-
PE/Fire™ 640 anti-human CD366 (Tim-3)
Follow Us