TotalSeq™-D0165 anti-human CD314 (NKG2D) Antibody

Pricing & Availability
Clone
1D11 (See other available formats)
Regulatory Status
RUO
Other Names
NKG2D
Isotype
Mouse IgG1, κ
Barcode Sequence
CGTGTTTGTTCCTCA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
320845 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD314 is a homodimeric C-type lectin-like protein also known as NKG2D. It is expressed on NK cells, CD8+ T cells, γ/δ T cells, and in vitro induced LAK cells. Several molecules have been identified as the ligands for NKG2D, including MHC class-I chain-related protein A (MICA), MICB, and UL16-binding proteins (ULBPs). NKG2D has no intrinsic signaling capacity, but attains this by non-covalent association with DAP10 or DAP12 adaptors. In addition to being a primary activation receptor on NK cells, NKG2D is also a costimulatory receptor for TCR-mediated T cell proliferation and cytokine production. The interaction of NKG2D with its ligands plays a role in the immune surveillance against pathogen and tumor cells, and in the pathogenesis of autoimmune diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 1D11 antibody blocks MICA binding to T cells, induces redirected lysis, and costimulates T cells activation and proliferation. Additional reported (for the relevant formats) applications include: immunoprecipitation1,2, blocking of ligand binding, induction of redirected cell lysis, and costimulation of T cells proliferation2-7. For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 320814) with endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Wu J, et al. 1999. Science 285:730.
  2. Wu J, et al. 2000. J. Exp. Med. 192:1059.
  3. Groh V, et al. 2001. Nature Immunol. 2:255.
  4. Wu J, et al. 2002. J. Immunol. 169:1236.
  5. Roberts A, et al. 2001. J. Immunol. 167:5527.
  6. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452.
  7. Kraetzel K et al. 2008. Eur. Respir. J. 32:563. PubMed
  8. Correia DV, et al. 2011. Blood 118:992. (FC) PubMed
  9. Watanbe M, et al. 2014. Int Immunol. PubMed
RRID
AB_2936601 (BioLegend Cat. No. 320845)

Antigen Details

Structure
C-type lectin
Distribution

NK cells, γ/δ T cells, CD8+ T cells

Function
Cytolytic killing of target cells expressing NKG2D ligands, costimulation of NK cells and T cells
Ligand/Receptor
MICA, MICB, UL16-binding proteins (ULBPs)
Cell Type
NK cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Vance RE, et al. 1999. J. Exp. Med. 190:1801.
2. Raulet DH. 2003. Nat. Rev. Immunol. 3:781.
3. Lohwasser S, et al. 1999. Eur. J. Immunol. 29:755.
4. Jamieson AM, et al. 2002. Immunity 17:19.
5. Gilfillan S, et al. 2002. Nat. Immunol. 3:1150.
6. Ho EL, et al. 2002. J. Immunol. 169:3667.
7. Maasho K, et al. 2005. J. Immunol. 174:4480.
8. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452.

Gene ID
22914 View all products for this Gene ID
UniProt
View information about CD314 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 02/06/2023

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD314 (NKG2D)

  • Biotin anti-human CD314 (NKG2D)

  • PE anti-human CD314 (NKG2D)

  • APC anti-human CD314 (NKG2D)

  • PE/Cyanine7 anti-human CD314 (NKG2D)

  • Ultra-LEAF™ Purified anti-human CD314 (NKG2D)

  • Brilliant Violet 510™ anti-human CD314 (NKG2D)

  • PerCP/Cyanine5.5 anti-human CD314 (NKG2D)

  • FITC anti-human CD314 (NKG2D)

  • Brilliant Violet 421™ anti-human CD314 (NKG2D)

  • APC/Cyanine7 anti-human CD314 (NKG2D)

  • Alexa Fluor® 647 anti-human CD314 (NKG2D)

  • PE/Dazzle™ 594 anti-human CD314 (NKG2D)

  • Brilliant Violet 785™ anti-human CD314 (NKG2D)

  • Brilliant Violet 605™ anti-human CD314 (NKG2D)

  • APC/Fire™ 750 anti-human CD314 (NKG2D)

  • TotalSeq™-A0165 anti-human CD314 (NKG2D)

  • TotalSeq™-C0165 anti-human CD314 (NKG2D)

  • TotalSeq™-B0165 anti-human CD314 (NKG2D)

  • Alexa Fluor® 660 anti-human CD314 (NKG2D) Antibody

  • PE/Cyanine5 anti-human CD314 (NKG2D)

  • TotalSeq™-D0165 anti-human CD314 (NKG2D)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account