TotalSeq™-D0142 anti-human CD32 Antibody

Pricing & Availability
Clone
FUN-2 (See other available formats)
Regulatory Status
RUO
Workshop
VI B051
Other Names
FCR II, FcγRII
Isotype
Mouse IgG2b, κ
Barcode Sequence
GCTTCCGAATTACCG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
303235 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD32 is a 40 kD polymorphic transmembrane glycoprotein also known as FcγRII and FCRII. It is an immunoglobulin superfamily member expressed on monocytes/macrophages, granulocytes, platelets and B cells. There are at least 6 isoforms of CD32 resulting from alternative mRNA splicing. CD32 mediates phagocytosis and oxidative burst in granulocytes, as well as platelet aggregation and immunomodulation. The extracellular domain of CD32 binds to polymeric and aggregated IgG and immune complexes, while the intracellular domain has been reported to associate with SHP-1 (B1 isoform).

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining3 of acetone-fixed frozen tissue sections. 

Clone FUN-2 recognizes both CD32A and CD32B.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Kishimoto T, et al. 1997. Leucocyte Typing VI Garland Press. London.
  2. Lerino F, et al. 1993. J. Immunol. 150:1794.
  3. Personal communication.
  4. van Tits L, et al. 2005. Arterioscler Thromb Vasc Biol. 25:717.PubMed
  5. Smeltz RB. 2007. J. Immunol. 178:4786.
  6. Satta N, et al. 2011. Blood. 117:5223. PubMed.
RRID
AB_2936569 (BioLegend Cat. No. 303235)

Antigen Details

Structure
Ig superfamily, polymorphic transmembrane glycoprotein, 40 kD
Distribution

Monocytes, granulocytes, B cells, platelets

Function
Endocytosis, cytotoxicity, platelet aggregation, B cell function
Ligand/Receptor
Aggregated IgG, immune complex
Cell Type
B cells, Dendritic cells, Granulocytes, Monocytes, Platelets
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Stuart S, et al. 1989. EMBO J. 8:3657.
2. Huang Y, et al. 1999. Scand. J. Immunol. 49:177.
3. Hisaka H, et al. 1999. Pathobiology 67:92.

Gene ID
2212 View all products for this Gene ID
UniProt
View information about CD32 on UniProt.org

Related FAQs

Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?

Yes

Go To Top Version: 1    Revision Date: 01/13/2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account