TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 or v3.1 (Single Index) Protocol

 

This is an updated version of our TotalSeq™-A antibodies and cell hashing with 10x Single Cell 3’ Reagent Kit v3 or v3.1 protocol. We update our protocols on a regular basis to provide improved guidance on use of our reagents and to enhance the user experience. For specific changes to this protocol, please see the change table at the bottom of the protocol. Last updated April 2021.

 

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third-party intellectual property rights to use that platform and TotalSeq™ with that platform.



The protocol below is intended for customers who are using TotalSeq™-A antibodies and cell hashing reagents with the 10x Single Cell 3’ Reagent Kit v3 or v3.1kit.

 

For customers using TotalSeq™-B  or TotalSeq™-C antibodies, please refer to our TotalSeq™-B or C protocol.

 

Please read the entire protocol below and the 10x Genomics user guide CG000185_Rev_D for v3 reagents and CG000206 Rev D for v3.1 reagents, before starting your experiments.

 

Please reach out to BioLegend Tech Services if you plan to use dual indices with this TotalSeq™-A protocol as there are some technical limitations at this time.


 

Commonly used abbreviations and terminology:

  • ADT - Antibody Derived Tag. Refers to a TotalSeq™ DNA-barcoded oligonucleotide that is directly conjugated to a specific antibody clone of interest.  Each antibody clone was raised against a specific extracellular protein epitope and can be used to characterize the expression of that surface antigen on cells.  Thus, ADTs serve as DNA tags used to catalog and quantify distinct surface protein expression levels.
  • HTOHash Tag Oligonucleotide. Refers to a TotalSeq™ DNA-Barcoded Oligonucleotide that is directly conjugated to a cocktail of two independent antibody clones that are specific for surface proteins known to be ubiquitously expressed on various cell types.  The intention of an HTO is to enable researchers to load multiple samples onto a single lane of a 10x chip and maintain the ability to determine sample origin.
  • CITE-Seq - Cellular Indexing of the Transcriptome and Epitopes by Sequencing. This application was first described by Stoeckius et al. (Nat Methods 14, 865–868 (2017)) of the NY Genome Center as they used antibodies coupled with oligonucleotides to simultaneously measure proteins and RNA at a single-cell level.
  • Cell Hashing – Application where oligo-tagged antibodies against ubiquitously expressed surface proteins uniquely label cells from distinct samples, which can be subsequently pooled. By sequencing these tags alongside the cellular transcriptome, users can assign each cell to its original sample.

 

TotalSeq™/Proteogenomics FAQ.

 

Multiomic Cytometry

Also known as CITE-seq, is a single-cell analysis technique in which cells are stained with antibodies conjugated to short DNA oligos. These oligos contain a sequence barcode, also known as antibody derived tag (ADT), which is used to identify targeted cellular surface epitopes. Protein and RNA expression can be then characterized in single cells, simultaneously. CITE-Seq can be paired with cell hashing to allow sample multiplexing during sequencing.

 

Compatibility:

Cell Hashing

TotalSeq™– A

TotalSeq™– B

TotalSeq™– C

Cell Hashing

A technique used to stain cells for multiplexing single-cell partitioned samples during sequencing. Each cell hashing reagent contains a mixture of two distinct monoclonal antibodies targeting distinct ubiquitous cellular surface epitopes. Each monoclonal antibody is conjugated with a short DNA oligo containing the same sequence barcode, also known as hashtag oligo (HTO). HTOs are used to correlate tagged cells with their sample of origin, as they can be mixed together after staining. Cell hashing is compatible with multiomic cytometry and other single-cell analysis techniques.

 

Compatibility:

Multiomic Cytometry

TotalSeqTM– A

TotalSeqTM– B

TotalSeqTM– C

 

 

Reagent and Instrument List


 

Primers used in sequencing library construction must be ordered from 3rd party vendors prior to starting the protocol:

 

ADT additive primer (0.2µM Stock) and/or HTO additive primer v2 (0.2µM Stock) (See notes at the end of the protocol for further details on primer sequences.)

 

TruSeq Small RNA RPIx (10µM Stock) and/or TruSeq D70x_LONG (10µM Stock) primers (See notes at the end of the protocol for further details on primer sequences.)

 

10x Genomics SI-PCR primer (10µM stock) (See notes at the end of the protocol for further details on primer sequences.)

 

For a full list of sequences, view the primer sequence table below.

 

For Cell Surface staining:

  • TotalSeq™-A antibodies and/or TotalSeq™-A hashtag reagents
  • Biotinylated antibody and oligo-barcoded streptavidin (optional)
  • Human TruStain FcX™ (Fc Receptor Blocking Solution) (BioLegend, Cat# 422301/422302)
  • TruStain FcX™ PLUS (anti-mouse CD16/32) (BioLegend, Cat# 156603/156604)
  • Phosphate Buffered Saline (PBS) (BioLegend, Cat# 926201 or equivalent)
  • Cell Staining Buffer (BioLegend, Cat# 420201)
  • 12 x 75mm Falcon™ Round-Bottom Polystyrene Tubes (Fisher Scientific, Cat# 14-959-1A or equivalent)
  • Flowmi™ Cell Strainer (Bel-Art, H-B Instrument, Cat# H13680-0040)

Optional

  • Curiox Laminar Washing
    Some users may be using the Curiox Laminar Wash system, which has equivalent performance to centrifugation-based washing.
  • Corning™ ThermalTray™ Thermo-conductive Platforms (Product Number 432074)

 

For library preparation:

  • Quantabio sparQ HiFi PCR Master Mix (2X) (Quantabio, Cat# 95192-250) or KAPA HiFi HotStart ReadyMix (2X) (Kapa Biosystems, Cat# KK2601)
  • Quantabio sparQ PureMag Beads (Quantabio, Cat# 951960) or SPRIselect reagent (Beckman Coulter, Cat# B23317)
  • 4200 Tapesation (Agilent Technologies, Cat# G2991A)
  • DNA High Sensitivity D1000 and High Sensitivity D5000 (Agilent, Cat# 5067-5584/5067-5592)
  • Qubit™ 3 (Thermo Fisher Scientific, Cat# Q33226)
  • Qubit™ dsDNA HS Assay Kit (Thermo Fisher, Cat# Q32854/Q32851)
  • ADT additive primer (0.2µM Stock) and/or HTO additive primer v2 (0.2µM Stock) (See notes at the end of the protocol for further details on primer sequences.)
  • TruSeq Small RNA RPIx (10µM Stock) and/or TruSeq D70x_s (10µM Stock) primers (See notes at the end of the protocol for further details on primer sequences.)

 

Other essential reagents:

  • Nuclease-free Water (Thermo Fisher, Cat# AM9937)
  • Ethanol (Sigma, Cat# E7023-500ML)
  • Nuclease-Free Pipette Tips (e.g. Thermo Fisher Scientific AM12650, AM12660 or equivalent)
  • TempAssure PCR 8-strips (USA Scientific, Cat# 1402-4700)
  • PCR Thermocycler (Bio-Rad, T100™ Thermal Cycler)
  • Countess™ II FL Automated Cell Counter (ThermoFisher, Cat# AMQAF1000)

 

Researchers are advised to validate equivalent products when substituting for the above recommendations.

 

Protocol


1) Cell labeling

  1. Prepare cell suspensions.
    • This protocol has been optimized using fresh human PBMCs isolated using Ficoll gradients and mouse splenocytes prepared using mechanical dissociation. If using cells isolated from whole lysed blood or other sample types, users may need to optimize staining concentrations.
    • BioLegend has not tested this protocol using single cell suspensions derived from enzymatically digested tissue. Enzymatic digestion may result in cleavage of epitopes and result in reduced staining with TotalSeq™ antibodies. Optimization of staining conditions and concentrations may be required.
  2. Assess Cell Viability.
    • Carefully count all cells to ensure accurate quantitation and assess cell viability.
    • Ideal cell viability is ≥ 95%.
      • Low cell viability is associated with generation of poor data and is not ideal for single cell experimentation.
      • If low cell viability is observed, users may need to enrich live cells or repeat cell suspension preparation. 
    • Contact Technical Services with any questions regarding cell viability. BioLegend uses Countess II for counting and assessing cell viability using the following protocol, however other methods for assessing cell viability are suitable. For more information about the protocol used by BioLegend, see the following link, details can be found under “PBMC viability assessment—general methods”.
  3. Dilute cells in appropriate volume prior to staining.
    • If working with human cells, dilute 1 million cells in 45μL of Cell Staining Buffer in 12 x 75mm flow cytometry tubes.
    • If working with mouse cells, dilute 1 million cells in 49.5μL of Cell Staining Buffer in 12 x 75mm flow cytometry tubes.
  4. Block cells.
    • Add 5 µl of Human TruStain FcX™ Fc Blocking reagent or 0.5 µl of TruStain FcX™ PLUS (anti-mouse CD16/32) antibody. The final blocking volume should be 50 µl.

      Note: We no longer recommend the use of dextran or monocyte blocker during blocking/staining. If you have any questions please contact BioLegend Technical Support.

    • Incubate for 10 min at 4°C.
    • While cells are incubating in Fc Block, proceed to step 5.
  5. Prepare antibody pool using titrated amounts (up to 1 µg) of each TotalSeq™, Cell Hashing, and/or biotinylated antibody. For more information regarding TotalSeq™ antibody concentrations, please reach out to BioLegend Tech Services.  When performing dual staining with Cell Hashing antibodies and TotalSeq™ antibodies we recommend adding Cell Hashing antibodies into each respective sample’s TotalSeq™ antibody pool. We do not recommend a 2-step staining due to observed poor performance.
    • If using biotinylated antibodies, we recommend staining with your primary antibody first followed by staining with streptavidin TotalSeq™ conjugates. Do not stain with more than 1 unique biotinylated antibody to use for detection.
  6. If antibody cocktail volume is less than 50 µL, add Cell Staining Buffer up to 50 µL, then centrifuge the antibody pool at 14,000 x g at 2 – 8°C for 10 minutes before adding to the cells. If volume of pool is above 50 µL, no volume adjustment is necessary.
    • If using an antibody cocktail larger than 50 µL, contact Tech Services or local Technical Applications Scientists for protocol guidance before proceeding with this protocol.  
  7. Carefully pipette out the prepared antibody pool, avoiding the bottom of the tube, and add the TotalSeq™ antibody cocktail to the 50 µL blocked-cell suspension.
    Note for Curiox Laminar Wash system users: Transfer 80μL* of cell suspension to one well of the Curiox Wash plate and place on the Thermal Tray** on ice.
    *80μL is the maximum volume of cells that can be used with Curiox Laminar Wash system.
    **Either ThermalTray or traditional incubation methods can be used

     

  8. Incubate for 30 minutes at 4°C.
    Note for Curiox Laminar Wash system users: Perform the following after step 8.
    • Transfer Curiox Wash Plate to the Curiox Laminar Wash System and wash using the following parameters (Flow Rate: 10, # of cycles: 25)
    • Remove Curiox Wash Plate from the system and add 40μL of wash buffer to the well containing the washed cells.
    • Resuspend by pipetting gently.
    • Proceed to step 11.
  9. Add 3 mL of Cell Staining Buffer and spin at 4°C for 5 minutes at 400 x g -600 x g depending on your sample type. Repeat wash 2 more times for a total of 3 washes.
    • BioLegend recommends the use of a swing bucket centrifuge as centrifuging with fixed angle rotors may lead to “smearing” of the cell pellet, which may result in cell loss. Contact Tech or local field representative if you have any questions.
    • BioLegend recommends manually pouring out supernatant being careful not to disrupt the cell pellet. Between 50-150 μL of residual supernatant will remain in the tube after decanting, which is taken into consideration in step 11 of this protocol. Do not try to forcefully remove any remaining liquid as this will disrupt the cell pellet and result in cell loss.
  10. If using a biotinylated primary antibody, incubate the stained cells with the appropriate oligo barcoded streptavidin at the recommended amount specified on the product technical datasheet for 20 minutes. Repeat step 9, then proceed to step 11.

     

  11. Add 200μL of Cell Staining Buffer to the cells for an approximate final volume of 250-350 µL.

     

  12. Slowly filter cells through 40 µm Flowmi™ Cell Strainer.

    Note: 40 µm Flowmi™ Cell Strainer may be too small for some sample types.

     

  13. Verify cell concentration and viability after filtration.

    Note: If using 10x Genomics Chromium Controller for single cell partitioning, we highly recommend determining cell viability. Ideally the viability should be >90% after filtration for optimal capture rate. The presence of a large number of non-viable cells can decrease the efficiency of cell partitioning and recovery within the 10x Genomics Chromium chip.

     

  14. Adjust cell concentration using PBS according to the input requirements of your single cell partitioning platform.

II) Run 10x Genomics single cell 3' v3 or v3.1 assay as described through Post Gem-RT Cleanup – Dynabeads (step 2.1). 10x Genomics Documents CG000185_Rev_D for v3 assay or CG000206_Rev_D for v3.1.

At cDNA amplification step (Step 2.2), use the following table:  

 

  ADT 1 rxn (µl) HTO 1rxn (µl) ADT + HTO 1 rxn (µl)
Amp Mix 50 50 50
cDNA Primers* 15 15 15
ADT Additive Primer (0.2 µM stock) 1 0 1
HTO Additive primer v2 (0.2 uM stock) 0 1 1
Total 66 66 67

* included with 10x Genomics 3’ kit, different from Feature cDNA primers 2.

 

Notes:
 

Follow steps 2.3A and 2.3B exactly to separate ADTs/HTOs from cDNA. Continue to use 70 µL of sparQ or SPRI beads in step 2.3B.

See notes at the end of the protocol for further details on primer sequences.

 

III) ADT and mRNA library preparation

  • A) Prepare Sample Index PCR Mix.
For ADT For HTO Volume (µl)
Purified ADT/HTO fraction Purified ADT/HTO fraction 5
SI PCR primer
(10uM stock)
SI PCR primer
(10uM stock)
2.5
TrueSeq Small RNA RPIx (10uM stock) TruSeq D70x_LONG primer
(10µM stock)
2.5
2X QuantaBio or Kapa Hifi Master Mix 2X QuantaBio or Kapa Hifi Master Mix 50
RNAse-free water RNAse-free Water 40
  Total 100

 

Note: For samples that contain both ADT and HTO, perform two separate reactions and add 5 µl of “purified ADT/HTO fraction” from the same sample to ADT or HTO reaction.

  •  
  • B) Incubate in a thermal cycler with the following protocol:

 

ADT
98°C 2min  
98°C 20sec 14 - 15 Cycles
60°C 30sec
72°C 20sec
72°C 5min  
4°C hold  
HTO
98°C 2min  
98°C 20sec 13 - 15 Cycles
64°C 30sec
72°C 20sec
72°C 5min  
4°C hold  

 

  •  
  • C) Post ADT/HTO library amplification clean-up
  1. Add 120 µl sparQ or SPRIselect Reagent (1.2X) to each sample.
  2. Incubate 5 min at room temperature.
  3. Place on the magnet in its High position until the solution clears.
  4. Carefully remove and discard the supernatant.
  5. Place tubes on magnet in its High position. Wash pellet twice with 200 µl 80% ethanol.
  6. Centrifuge briefly. Place on the magnet Low. Remove remaining ethanol.
  7. Remove from the magnet. Add 40.5 µl water.
  8. Incubate 2 min at room temperature.
  9. Place on the magnet in its Low position until the solution clears.
  10. Transfer 40 µl to a new tube strip. Store at 4°C for up to 72 h or at −20°C for long-term storage.
  11. ADT/HTO libraries are now ready to be sequenced
    Quantify libraries by standard methods (QuBit, BioAnalyzer, qPCR).     
    ADT libraries will be around 180 bp (Figure 1B).


Sequencing CITE-seq libraries:

To obtain sufficient read coverage for both libraries, we typically sequence ADT libraries in 5-10% of a lane and cDNA library fraction at 90% of a lane (HiSeq2500 Rapid Run Mode Flow Cell). See table below for sequencing depth recommendations

 

Library Type

Minimum Sequencing Depth
(reads/cell)

3' Gene Expression Library

20,000-50,000

Cell Surface Protein Library <100 ADT panel

5,000

Cell Surface Protein Library ≥100 ADT panel

10,000

Cell Hashing Libraries

500

 

Notes:

Oligonucleotide sequences:

TotalSeq™ antibodies. Each clone is barcoded with a unique oligonucleotide sequence. These contain standard small TruSeq RNA read 2 sequences and can be amplified using Illumina’s Truseq Small RNA primer sets (RPIx – primers, see example RPI1 below)

CCTTGGCACCCGAGAATTCCAAACAAGACCCTTGAGBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.


Please visit https://www.biolegend.com/totalseq for detailed information:

Oligos required for ADT library amplification:

  • PAGE purification is the preferred method when ordering primers.
  • The phosphorothioate bonds in the primer renders the oligonucleotide resistant to nuclease degradation.
  • A unique Illumina primer (index) should be used for each 10x Genomics sample lane used within one sequencing lane.

 

  1. 10x Genomics SI-PCR primer 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C
  2. ADT cDNA PCR additive primer 5’CCTTGGCACCCGAGAATT*C*C
  3. HTO cDNA PCR additive primer v2 5’GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
  4. Illumina Small RNA RPI1 primer (for ADT amplification; i7 index 1, Oligonucleotide sequences, Illumina) 5’CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
  5. Illumina TruSeq D701_LONG primer (for HTO amplification; i7 index 1) 5’CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

* indicates a phosphorothioate bond
B indicates C or G or T; not A nucleotide

 

Primers Used for Sequencing Library Construction:

 

Name

Sequence 5’ -> 3’

Do Not Use with 10x Index

SI-PCR primer

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C

HTO additive primer v2

GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

 

ADT additive primer

CCTTGGCACCCGAGAATT*C*C

 
     

D701_LONG

CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D702_LONG

CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D703_LONG

CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D704_LONG

CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D705_LONG

CAAGCAGAAGACGGCATACGAGATTTCTGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D706_LONG

CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D707_LONG

CAAGCAGAAGACGGCATACGAGATAGCTTCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D708_LONG

CAAGCAGAAGACGGCATACGAGATGCGCATTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D709_LONG

CAAGCAGAAGACGGCATACGAGATCATAGCCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D710_LONG

CAAGCAGAAGACGGCATACGAGATTTCGCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

D711_LONG

CAAGCAGAAGACGGCATACGAGATGCGCGAGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

SI-GA-E7

D712_LONG

CAAGCAGAAGACGGCATACGAGATCTATCGCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

SI-GA-A10

     

RPI1

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

RPI2

CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

RPI3

CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

RPI4

CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

RPI5

CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

RPI6

CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

RPI7

CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

SI-GA-A11

RPI8

CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

 

Representative Data and Troubleshooting

 

A.
B.

Figure 1. ADT library verification.
(Left graph) A TSO-RT-oligo product (~140 bp) can be amplified during the ADT PCR by carryover primers from cDNA amplification. The product will not cluster but will interfere with quantification. Sequential 2X sparQ or SPRI purification of the ADT fraction after cDNA amplification reduces carryover of primers from cDNA amplification, and minimizes the amplification of this product during ADT-library amplification. To further enrich for ADT specific product the purified ADT library can be reamplified for 3 additional cycles with ADT specific primer sets or P5/P7 generic primers. (Right graph) A clean ADT library will contain a predominant single peak at around 180 bp.


 


Figure 2. My ADT/HTO library contains a large peak at ~400bp
Overamplification of a library can lead to depletion of available primers and/or dNTPs resulting in self-priming of PCR products by their P5 and/or P7 adapters. This can lead to the production of “daisy-chains” or “bubble products”. These products consist of essentially 2 ADT or HTO barcode sequences attached to one another in 1 long oligo tag that is twice as long as the original oligo tag; these products appear as peaks at approximately 400 bp. These peaks can be more or less pronounced (panel A and B respectively).  

The larger peak is perfectly acceptable to sequence. However, it is difficult to quantify these libraries to titrate for sequencing. This error can be corrected by performing another PCR reaction using generic P5/P7 primers (not used in the protocol) for one or two cycles on the 1.2x sparQ or SPRI cleaned up product. The PCR reaction will convert the larger product to the desired size product partially (panel C) or completely (panel D) as the major peak.

 


 

Version Change Table

 

Date Section Changes
04/2021 Reagents and Instrument List Added 10x Genomics SI-Primer to list of primers that must be ordered from 3rd party vendors
04/2021 Section 5 Updated guidance on TotalSeq™ antibody preparation
04/2021

Introduction and Section 2

Updated links to 10x Genomics User Manual

12/2020

Section 1 step 1

Added general information regarding types of cells and cell isolation methods used during testing. Also, added information regarding cells isolated via enzymatic digestion of whole tissues.

12/2020

Section 1 step 2

Added information regarding methods used to assess cell viability

12/2020

Section 1 step 5

Added “Contact Technical Services” regarding antibody staining concentrations.

12/2020

Section 1 step 8

Added protocol information for the use of the Curiox Laminar Washing System

12/2020

Section 1 step 9

Reduced wash volumes from 3.5mL to 3mL

12/2020

Section 1 step 9

Changed centrifugation speed recommendation from 400 x g to 400 x g -600 x g

12/2020

Section 1 step 11

Changed resuspension volume from 500 µL to 250-350 µL

12/2020

Section 3 PCR conditions

Changed conditions from 12-13 cycles to 13-15 cycles when amplifying HTO libraries

12/2020

Section 3 Sequencing depth recommendations

Added recommended sequencing depths

12/2020

Primer sequences table

Provided longer D70X primer sequences to help reduce the occurrence of HTO drop outs.

ProductsHere
Insert Note Here
Save Close Clear
Lab Timer
Tools
Login/Register
Remember me
Forgot your password? Reset Password
Request an Account