TotalSeq™-D1374 anti-human CD159a (NKG2A) Antibody

Pricing & Availability
Clone
S19004C (See other available formats)
Regulatory Status
RUO
Other Names
Killer Cell Lectin Like Receptor C1, KLRC1, NK Cell Receptor A
Isotype
Mouse IgG1, κ
Barcode Sequence
CAACTCCTGGGACTT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
375133 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD159a, also known as NKG2A or KLRC1, is a type II transmembrane protein. It belongs to the killer cell lectin-like receptor family also known as the NKG2 family. It is expressed on NK and NKT cells and T cell subsets. NKG2A is an inhibitory NK cell receptor and it is expressed as a heterodimer with CD94. In human, NKG2A/CD94 complex interacts HLA-E on target cells and inhibits T cells and NK cell effector functions. Recent studies showed that NKG2A blockade enhances the anti-tumor effect of NK cell and CD8+ T cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human NKG2A/CD94-transfectants
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone S19004C does not cross-react with mouse CD159a.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2936648 (BioLegend Cat. No. 375133)

Antigen Details

Structure
Type II transmembrane proteins of the C-type lectin superfamily
Distribution

NK cells, NKT cells, T cell subsets

Function
Inhibiting NK cell receptor
Ligand/Receptor
HLA-E
Cell Type
Lymphocytes, NK cells, NKT cells, T cells
Biology Area
Immuno-Oncology, Immunology
Molecular Family
Immune Checkpoint Receptors
Antigen References
  1. Brooks AG, et al. 1999. J Immunol. 162:305-13.
  2. Kaiser BK, et al. 2008. Proc Natl Acad Sci U S A. 105: 6696-701.
  3. Braud VM, et al. 2003. Trends Immunol. 24:162-4.
  4. Kamiya T, et al. 2019. J Clin Invest. 129:2094.
  5. André P, et al. 2018. Cell. 175:1731.
Gene ID
3821 View all products for this Gene ID
UniProt
View information about CD159a on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD159a Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD159a (NKG2A) S19004C FC
PE anti-human CD159a (NKG2A) S19004C FC
APC anti-human CD159a (NKG2A) Antibody S19004C FC
Pacific Blue™ anti-human CD159a (NKG2A) Antibody S19004C FC
PE/Cyanine7 anti-human CD159a (NKG2A) Antibody S19004C FC
Alexa Fluor® 647 anti-human CD159a (NKG2A) Antibody S19004C FC
PE/Cyanine5 anti-human CD159a (NKG2A) S19004C FC
APC/Fire™ 750 anti-human CD159a (NKG2A) S19004C FC
Alexa Fluor® 700 anti-human CD159a (NKG2A) Antibody S19004C FC
PE/Dazzle™ 594 anti-human CD159a (NKG2A) Antibody S19004C FC
Biotin anti-human CD159a (NKG2A) Antibody S19004C FC
Alexa Fluor® 488 anti-human CD159a (NKG2A) S19004C FC
PerCP/Cyanine5.5 anti-human CD159a (NKG2A) S19004C FC
FITC anti-human CD159a (NKG2A) S19004C FC
TotalSeq™-C1374 anti-human CD159a (NKG2A) S19004C PG
TotalSeq™-D1374 anti-human CD159a (NKG2A) S19004C PG
TotalSeq™-A1374 anti-human CD159a (NKG2A) S19004C PG
APC/Fire™ 810 anti-human CD159a (NKG2A) S19004C FC
Brilliant Violet 421™ anti-human CD159a (NKG2A) S19004C FC
Brilliant Violet 605™ anti-human CD159a (NKG2A) S19004C FC
Brilliant Violet 785™ anti-human CD159a (NKG2A) S19004C FC
TotalSeq™-B1374 anti-human CD159a (NKG2A) S19004C PG
PerCP/Fire™ 806 anti-human CD159a (NKG2A) S19004C FC
PerCP/Fire™ 780 anti-human CD159a (NKG2A) S19004C FC
PE/Fire™ 810 anti-human CD159a (NKG2A) S19004C FC
APC/Cyanine7 anti-human CD159a (NKG2A) S19004C FC
Brilliant Violet 650™ anti-human CD159a (NKG2A) S19004C FC
Spark Red™ 718 anti-human CD159a (NKG2A) (Flexi-Fluor™) S19004C FC
Go To Top Version: 1    Revision Date: 03/03/2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account