- Clone
- HIB19 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V CD19.11
- Other Names
- B4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTGGGCAATTACTCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
302277 | 10 µg | 296€ |
CD19 is a 95 kD type I transmembrane glycoprotein also known as B4. It is a member of the immunoglobulin superfamily expressed on B-cells (from pro-B to blastoid B cells, absent on plasma cells) and follicular dendritic cells. CD19 is involved in B cell development, activation, and differentiation. CD19 forms a complex with CD21 (CR2) and CD81 (TAPA-1), and functions as a BCR co-receptor.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections8 and blocking of B cell proliferation. Clone HIB19 is not recommended for formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302267 & 302268).
Clone HIB19 partially blocks anti-human CD19 clones 4G7 and SJ25C1 staining based on in-house testing
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Schlossman S, et al. 1995. Leucocyte Typing V. Oxford University Press. New York.
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
- Bradbury L, et al. 1993. J. Immunol. 151:2915.
- Joseph A, et al. 2010. J. Virol. 84:6645. PubMed
- Wang X, et al. 2010. Haematologica. 95:884. (FC) PubMed
- Walker JD, et al. 2009. J. Immunol. 182:1548. (Block) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Hansen A, et al. 2002. Arthritis Rheum. 46:2160. (IHC)
- Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- RRID
-
AB_2892349 (BioLegend Cat. No. 302277)
Antigen Details
- Structure
- Ig superfamily, type I transmembrane glycoprotein, 95 kD
- Distribution
-
B lineage (except plasma cells), follicular dendritic cells
- Function
- B cell activation and differentiation
- Ligand/Receptor
- Forms complex with CD21 (CR2) and CD81 (TAPA-1), BCR coreceptor
- Cell Type
- B cells, Dendritic cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Tedder T, et al. 1994. Immunol. Today 15:437.
2. Bradbury L, et al. 1993. J. Immunol. 151:2915. - Gene ID
- 930 View all products for this Gene ID
- Specificity (DOES NOT SHOW ON TDS):
- CD19
- Specificity Alt (DOES NOT SHOW ON TDS):
- CD19
- App Abbreviation (DOES NOT SHOW ON TDS):
- PG
- UniProt
- View information about CD19 on UniProt.org
Related FAQs
Other Formats
View All CD19 Reagents Request Custom ConjugationCustomers Also Purchased
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD19
-
Biotin anti-human CD19
-
FITC anti-human CD19
-
PE anti-human CD19
-
PE/Cyanine5 anti-human CD19
-
Purified anti-human CD19
-
APC/Cyanine7 anti-human CD19
-
PE/Cyanine7 anti-human CD19
-
Alexa Fluor® 488 anti-human CD19
-
Alexa Fluor® 647 anti-human CD19
-
Pacific Blue™ anti-human CD19
-
Alexa Fluor® 700 anti-human CD19
-
PerCP anti-human CD19
-
PerCP/Cyanine5.5 anti-human CD19
-
Brilliant Violet 421™ anti-human CD19
-
Brilliant Violet 570™ anti-human CD19
-
Brilliant Violet 650™ anti-human CD19
-
Brilliant Violet 785™ anti-human CD19
-
Brilliant Violet 510™ anti-human CD19
-
Brilliant Violet 605™ anti-human CD19
-
Brilliant Violet 711™ anti-human CD19
-
Purified anti-human CD19 (Maxpar® Ready)
-
Alexa Fluor® 594 anti-human CD19
-
PE/Dazzle™ 594 anti-human CD19
-
PE anti-human CD19
-
APC/Fire™ 750 anti-human CD19
-
Pacific Blue™ anti-human CD19
-
APC anti-human CD19
-
PE/Cyanine7 anti-human CD19
-
TotalSeq™-A0050 anti-human CD19
-
Brilliant Violet 750™ anti-human CD19
-
TotalSeq™-B0050 anti-human CD19
-
TotalSeq™-C0050 anti-human CD19
-
PerCP/Cyanine5.5 anti-human CD19
-
Spark NIR™ 685 anti-human CD19
-
Ultra-LEAF™ Purified anti-human CD19
-
APC/Fire™ 810 anti-human CD19
-
PE/Fire™ 640 anti-human CD19
-
PE/Fire™ 700 anti-human CD19
-
TotalSeq™-D0050 anti-human CD19
-
Spark YG™ 593 anti-human CD19
-
GMP Pacific Blue™ anti-human CD19
-
Spark Violet™ 423 anti-human CD19
-
GMP PE anti-human CD19
-
GMP APC anti-human CD19
-
KIRAVIA Blue 520™ anti-human CD19
-
GMP PerCP/Cyanine5.5 anti-human CD19
-
GMP PE/Cyanine7 anti-human CD19
-
Spark Violet™ 500 anti-human CD19
-
PE/Fire™ 810 anti-human CD19
-
Spark Violet™ 423 anti-human CD19
-
Spark UV™ 387 anti-human CD19
-
APC/Fire™ 750 anti-human CD19
-
PE/Cyanine5 anti-human CD19
-
Alexa Fluor® 660 anti-human CD19
-
PerCP/Fire™ 806 anti-human CD19
-
PerCP/Fire™ 780 anti-human CD19
-
Spark PLUS UV™ 395 anti-human CD19
-
Spark Red™ 718 anti-human CD19
Follow Us