TotalSeq™-A0572 anti-human C5L2 Antibody

Pricing & Availability
Clone
1D9-M12 (See other available formats)
Other Names
GPR77, C5a receptor-like 2, C5a anaphylatoxin chemotactic receptor
Isotype
Mouse IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
342407 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

C5L2 (C5a receptor-like 2) is a seven-transmembrane orphan receptor, also known as GPR77, which shares significant homology to C5a receptor (CD88), but it is a decoy receptor without G-protein coupling. C5L2 is co-expressed with C5aR on many kinds of cells, such as neutrophils, immature dendritic cells, mast cells, macrophages, and astrocytes. C5L2 binds C5a with similar high affinity as C5aR and relatively higher affinity for C5a-des-Arg than with C5aR.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications include: Western blotting1,3 and blocking2,3. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for functional assays (contact our custom solutions team).

Clone 1D9-M12 is known to block C5a binding to C5L2, but does not react with C5a receptor. It has been reported that this clone is not effective in immunohistochemistry of formalin-fixed paraffin-embedded sections1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone 1D9-M12  is ACAATTTGTCTGCGA.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [ACAATTTGTCTGCGA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Fonseca MI, et al. 2013. J. Neuroinflammation. 10:25. (WB) PubMed
  2. Hao J, et al. 2013. PLoS One 8:e66305. (Block)
  3. Raby AC, et al. 2011. Eur. J. Immunol. 41:2741. (Block, WB)
RRID
AB_2783226 (BioLegend Cat. No. 342407)

Antigen Details

Structure
Seven transmembrane protein, decoy receptor, does not couple to G-proteins.
Distribution

Neutrophils, immature dendritic cells, mast cells, macrophages, and astrocytes.

Function
Negative regulation of C5a function.
Ligand Receptor
C5a, C5a-des-Arg.
Cell Type
Astrocytes, Dendritic cells, Macrophages, Mast cells, Neutrophils
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family
Cytokine/Chemokine Receptors
Antigen References

1. Scola AM, et al. 2009. Mol. Immunol. 46:1149
2. Johswich K, et al. 2006. J. Bio. Chem. 281:39088
3. Gerad NP, et al. 2005. J. Bio. Chem. 280:39677
4. Okinaga S, et al. 2003. Biochemistry. 42:9406

Gene ID
27202 View all products for this Gene ID
UniProt
View information about C5L2 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/05/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account