- Clone
- 1D9-M12 (See other available formats)
- Other Names
- GPR77, C5a receptor-like 2, C5a anaphylatoxin chemotactic receptor
- Isotype
- Mouse IgG2a, κ
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Avail. | Save | ||
|---|---|---|---|---|---|---|
| 342407 | 10 µg | £218 | ||||
C5L2 (C5a receptor-like 2) is a seven-transmembrane orphan receptor, also known as GPR77, which shares significant homology to C5a receptor (CD88), but it is a decoy receptor without G-protein coupling. C5L2 is co-expressed with C5aR on many kinds of cells, such as neutrophils, immature dendritic cells, mast cells, macrophages, and astrocytes. C5L2 binds C5a with similar high affinity as C5aR and relatively higher affinity for C5a-des-Arg than with C5aR.
Product DetailsProduct Details
- Reactivity
- Human, African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.
To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: Western blotting1,3 and blocking2,3. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for functional assays (contact our custom solutions team).
Clone 1D9-M12 is known to block C5a binding to C5L2, but does not react with C5a receptor. It has been reported that this clone is not effective in immunohistochemistry of formalin-fixed paraffin-embedded sections1.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The TotalSeq™-A barcode sequence associated with clone 1D9-M12 is ACAATTTGTCTGCGA.
The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [ACAATTTGTCTGCGA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A. -
Application References
(PubMed link indicates BioLegend citation) -
- Fonseca MI, et al. 2013. J. Neuroinflammation. 10:25. (WB) PubMed
- Hao J, et al. 2013. PLoS One 8:e66305. (Block)
- Raby AC, et al. 2011. Eur. J. Immunol. 41:2741. (Block, WB)
- RRID
-
AB_2783226 (BioLegend Cat. No. 342407)
Antigen Details
- Structure
- Seven transmembrane protein, decoy receptor, does not couple to G-proteins.
- Distribution
-
Neutrophils, immature dendritic cells, mast cells, macrophages, and astrocytes.
- Function
- Negative regulation of C5a function.
- Ligand Receptor
- C5a, C5a-des-Arg.
- Cell Type
- Astrocytes, Dendritic cells, Macrophages, Mast cells, Neutrophils
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
- Molecular Family
- Cytokine/Chemokine Receptors
- Antigen References
-
1. Scola AM, et al. 2009. Mol. Immunol. 46:1149
2. Johswich K, et al. 2006. J. Bio. Chem. 281:39088
3. Gerad NP, et al. 2005. J. Bio. Chem. 280:39677
4. Okinaga S, et al. 2003. Biochemistry. 42:9406 - Gene ID
- 27202 View all products for this Gene ID
- UniProt
- View information about C5L2 on UniProt.org
Related FAQs
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.