- Clone
- 581 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V MA27
- Other Names
- Gp105-120, My10
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCAGAAATCTCCCTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
343543 | 10 µg | 296€ |
CD34, also known as gp105-120, is a type I monomeric sialomucin-like glycophosphoprotein with an approximate molecular weight of 105-120 kD. Selectively expressed on the majority of hematopoietic stem/progenitor cells, bone marrow stromal cells, capillary endothelial cells, embryonic fibroblasts, and some nervous tissue, CD34 is a commonly used marker to identify human hematopoietic stem/progenitor cells. According to the differential sensitivity to enzymatic cleavage, four groups of epitopes of CD34 have been described. CD34 mediates cell adhesion and lymphocytes homing through binding to L-selectin and E-selectin ligands.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The 581 antibody recognizes the class III group epitope which is resistant to sialidase/glycolyprotease and chymopapain treatment. Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections5 and immunofluorescence6.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman SF, et al. 1995. Leukocyte Typing V:White Cell Differentiation Antigen. New York:Oxford University Press.
- Felschow DM, et al. 2001. Blood 97:3768.
- Rudin CE, et al. 1997. Br. J. Haematol. 97:488.
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Skowasch D, et al. 2003. Cardiovasc Res. 60:684. (IHC)
- Umland O, et al. 2003. J. Histochem. Cytochem. 51:977. (IF)
- RRID
-
AB_2892416 (BioLegend Cat. No. 343543)
Antigen Details
- Structure
- 105-120 kD single chain mucin-like glycoprotein
- Distribution
-
Hematopoietic stem/progenitor cells, bone marrow stromal cells, endothelial cells, embryonic fibroblasts
- Function
- Cell adhesion
- Ligand/Receptor
- L-selectin, E-selectin
- Cell Type
- Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors
- Biology Area
- Cell Biology, Immunology, Neuroinflammation, Neuroscience, Stem Cells
- Molecular Family
- CD Molecules
- Antigen References
-
1. Krause DS, et al. 1996. Blood 87:1.
2. Puri KD, et al. 1995. J. Cell Biol. 131:261.
3. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. John Wiley & Sons Inc, Hoboken New Jersey. - Gene ID
- 947 View all products for this Gene ID
- Specificity (DOES NOT SHOW ON TDS):
- CD34
- Specificity Alt (DOES NOT SHOW ON TDS):
- CD34
- App Abbreviation (DOES NOT SHOW ON TDS):
- PG
- UniProt
- View information about CD34 on UniProt.org
Related FAQs
Other Formats
View All CD34 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD34 | 581 | FC,CyTOF®,ICC,IHC-P |
FITC anti-human CD34 | 581 | FC |
PE anti-human CD34 | 581 | FC |
Alexa Fluor® 647 anti-human CD34 | 581 | FC |
APC anti-human CD34 | 581 | FC |
Pacific Blue™ anti-human CD34 | 581 | FC |
APC/Cyanine7 anti-human CD34 | 581 | FC |
PE/Cyanine7 anti-human CD34 | 581 | FC |
Alexa Fluor® 488 anti-human CD34 | 581 | FC |
PerCP anti-human CD34 | 581 | FC |
PerCP/Cyanine5.5 anti-human CD34 | 581 | FC |
Biotin anti-human CD34 | 581 | FC |
Alexa Fluor® 700 anti-human CD34 | 581 | FC |
Brilliant Violet 510™ anti-human CD34 | 581 | FC |
Purified anti-human CD34 (Maxpar® Ready) | 581 | FC,CyTOF® |
PE/Dazzle™ 594 anti-human CD34 | 581 | FC |
APC/Fire™ 750 anti-human CD34 | 581 | FC |
TotalSeq™-A0054 anti-human CD34 | 581 | PG |
TotalSeq™-B0054 anti-human CD34 | 581 | PG |
TotalSeq™-C0054 anti-human CD34 | 581 | PG |
TotalSeq™-D0054 anti-human CD34 | 581 | PG |
Spark Red™ 718 anti-human CD34 | 581 | FC |
Cell-Vive™ GMP Ultra-LEAF™ Purified anti-human CD34 SF | 581 | FC,ICC,IHC-P,CyTOF® |
Spark PLUS UV™ 395 anti-human CD34 | 581 | FC |
Customers Also Purchased
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD34
-
FITC anti-human CD34
-
PE anti-human CD34
-
Alexa Fluor® 647 anti-human CD34
-
APC anti-human CD34
-
Pacific Blue™ anti-human CD34
-
APC/Cyanine7 anti-human CD34
-
PE/Cyanine7 anti-human CD34
-
Alexa Fluor® 488 anti-human CD34
-
PerCP anti-human CD34
-
PerCP/Cyanine5.5 anti-human CD34
-
Biotin anti-human CD34
-
Alexa Fluor® 700 anti-human CD34
-
Brilliant Violet 510™ anti-human CD34
-
Purified anti-human CD34 (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-human CD34
-
APC/Fire™ 750 anti-human CD34
-
TotalSeq™-A0054 anti-human CD34
-
TotalSeq™-B0054 anti-human CD34
-
TotalSeq™-C0054 anti-human CD34
-
TotalSeq™-D0054 anti-human CD34
-
Spark Red™ 718 anti-human CD34
-
Cell-Vive™ GMP Ultra-LEAF™ Purified anti-human CD34 SF
-
Spark PLUS UV™ 395 anti-human CD34
Follow Us