TotalSeq™-D0139 anti-human TCR γ/δ Antibody

Pricing & Availability
B1 (See other available formats)
Regulatory Status
Other Names
T cell receptor γ/δ, γ/δ TCR, TCR-γ/δ
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
331241 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

T cell receptor (TCR) is a heterodimer consisting of an α and a β chain (TCR α/β) or a γ and a δ chain (TCR γ/δ). TCR γ/δ is involved in the recognition of certain bacterial, self-CD1 molecule, and tumor antigens bound to MHC class I. The γ/δ TCR associates with CD3 and is expressed on a subset of T cells found in the thymus, the intestinal epithelium, and the peripheral lymphoid tissues and peritoneum. Most γ/δ T cells are CD4-/CD8-, some are CD8+. T cells expressing the γ/δ TCR have been shown to play a role in oral tolerance, innate immune response for some tumor cells, and autoimmune disease. It has been reported that γ/δ T cells also play a principal role in antigen presentation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Pigtailed Macaque
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone B1 is also known as clone B1.1.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections3 and paraffin-embedded sections5, in vitro blocking, and spatial biology (IBEX)8,9. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays (Cat. Nos. 331235 and 331236).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Rodriguez-Gago M, et al. 2001. Transplantation. 72:503.
  2. Lehmann FS, et al. 2002. Am. J. Physiol. Gastrointest. Liver. Physiol. 283:G481. (FC)
  3. Bordignon M, et al. 2008. Mol. Med. Rep. 1:485. (IHC)
  4. Conrad M, et al. 2007. Cytom. Part A 71A:925. (FC)
  5. Pollinger B, et al. 2011. J. Immunol. 186:2602. (IHC)
  6. Correia DV, et al. 2011. Blood. 118:992. (Block)
  7. Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed
  8. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  9. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2892399 (BioLegend Cat. No. 331241)

Antigen Details

Ig superfamily, associates with CD3 complex

T subset in thymus, intestinal epithelium, peripheral lymphoid tissues and peritoneum

Antigen recognition
Some bacterial or tumor antigens bound MHC class I, CD1 molecule
Cell Type
Epithelial cells, T cells
Biology Area
Adaptive Immunity, Immunology
Molecular Family
Antigen References

1. Lanier LL, et al. 1987. J. Clin. Immunol. 7:429.
2. Spencer J, et al. 1989. Eur. J. Immunol. 19:1335.
3. Uyemura K, et al. 1991. J. Exp. Med. 174:683.
4. Spada FM, et al. 2000. J. Exp. Med. 191:907.

Gene ID
6964 View all products for this Gene ID 6965 View all products for this Gene ID
View information about TCR gamma/delta on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human TCR γ/δ

  • Biotin anti-human TCR γ/δ

  • FITC anti-human TCR γ/δ

  • PE anti-human TCR γ/δ

  • APC anti-human TCR γ/δ

  • Alexa Fluor® 647 anti-human TCR γ/δ

  • Brilliant Violet 421™ anti-human TCR γ/δ

  • Brilliant Violet 510™ anti-human TCR γ/δ

  • PE/Cyanine7 anti-human TCR γ/δ

  • PerCP/Cyanine5.5 anti-human TCR γ/δ

  • PE/Dazzle™ 594 anti-human TCR γ/δ

  • APC/Fire™ 750 anti-human TCR γ/δ

  • TotalSeq™-A0139 anti-human TCR γ/δ

  • TotalSeq™-C0139 anti-human TCR γ/δ

  • TotalSeq™-B0139 anti-human TCR γ/δ

  • Ultra-LEAF™ Purified anti-human TCR γ/δ

  • PE/Fire™ 700 anti-human TCR γ/δ Antibody

  • Alexa Fluor® 660 anti-human TCR γ/δ Antibody

  • TotalSeq™-D0139 anti-human TCR γ/δ


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account