BioLegend TotalSeq
Antibody-oligonucleotide conjugates are required in a number of expanding applications, particularly in single cell multiomics where extensive data sets can be generated at the molecular level from a single cell. Cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) combines scRNA-Seq and Proteomics in one application, to quantify RNA and protein at the same time. This page explores the capabilities of custom antibody-oligo conjugations, and their applications.

TotalSeq™ format antibodies are BioLegend’s proprietary patent pending technology. Contact us if you are interested in partnering with us around this technology.
TotalSeq™ Barcodes   Overview   CITE-seq workflow and data   Cell Hashing   Inquiry Form
View and Order
TotalSeq™-A Products…

Sequences in the table below were designed to work with Illumina sequencers and the 10X Genomics platform but should work in any other droplet-based cell-isolation system. The full name of the product includes the associated platform, the barcode identifier, and the target molecule. For example, a conjugated antibody against human CD80 would be named TotalSeq™-A0005 anti-human CD80. Barcodes are clone-specific. The full sequence of the oligonucleotide includes a PCR handle (CCTTGGCACCCGAGAATTCCA), the 15 bp barcode in the table below, and a poly A tail (BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A).

The oligonucleotide sequence for a readily available anti-mouse CD4 conjugate, clone RM4-5, is CCTTGGCACCCGAGAATTCCAAACAAGACCCTTGAGBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A. The name of this product is TotalSeq™-A0001 anti-mouse CD4.

Search by specificity or clone name

Download Table
CategoryBarcode ▼Specificity ▼Clone ▼Reactivity ▼Barcode sequence
TotalSeq™-A1CD4RM4-5MouseAACAAGACCCTTGAG
TotalSeq™-A2CD8a53-6.7MouseTACCCGTAATAGCGT
TotalSeq™-A3CD366 (Tim-3)RMT3-23MouseATTGGCACTCAGATG
TotalSeq™-A4CD279 (PD-1)RMP1-30MouseGAAAGTCAAAGCACT
TotalSeq™-A5CD802D10HumanACGAATCAATCTGTG
TotalSeq™-A6CD86IT2.2HumanGTCTTTGTCAGTGCA
TotalSeq™-A7CD274 (B7-H1, PD-L1)29E.2A3HumanGTTGTCCGACAATAC
TotalSeq™-A8CD273 (B7-DC, PD-L2)24F.10C12HumanTCAACGCTTGGCTAG
TotalSeq™-A9CD275 (B7-H2, ICOSL)2D3HumanGTGCATTCAACAGTA
TotalSeq™-A10CD276 (B7-H3)DCN.70HumanGACTGGGAGGGTATT
TotalSeq™-A12CD117 (c-kit)2B8MouseTGCATGTCATCGGTG
TotalSeq™-A13Ly-6CHK1.4MouseAAGTCGTGAGGCATG
TotalSeq™-A14CD11bM1/70MouseTGAAGGCTCATTTGT
TotalSeq™-A15Ly-6G1A8MouseACATTGACGCAACTA
TotalSeq™-A20CD270 (HVEM, TR2)122HumanTGATAGAAACAGACC
TotalSeq™-A22CD137L (4-1BB Ligand)5F4HumanATTCGCCTTACGCAA
TotalSeq™-A23CD155 (PVR)SKII.4HumanATCACATCGTTGCCA
TotalSeq™-A24CD112 (Nectin-2)TX31HumanAACCTTCCGTCTAAG
TotalSeq™-A25Annexin VNAGCAGCGTATAAGTCA
TotalSeq™-A26CD47CC2C6HumanGCATTCTGTCACCTA
TotalSeq™-A27CD70113-16HumanCGCGAACATAAGAAG
TotalSeq™-A28CD30BY88HumanTCAGGGTGTGCTGTA
TotalSeq™-A29CD48BJ40HumanCTACGACGTAGAAGA
TotalSeq™-A30CD277BT3.1HumanTACTTCTGGAGCCAG
TotalSeq™-A31CD405C3HumanCTCAGATGGAGTATG
TotalSeq™-A32CD15424-31HumanGCTAGATAGATGCAA
TotalSeq™-A33CD52HI186HumanCTTTGTACGAGCAAA
TotalSeq™-A34CD3UCHT1HumanCTCATTGTAACTCCT
TotalSeq™-A45CD4SK3HumanGAGGTTAGTGATGGA
TotalSeq™-A46CD8SK1HumanGCGCAACTTGATGAT
TotalSeq™-A47CD565.1H11HumanTCCTTTCCTGATAGG
TotalSeq™-A48CD452D1HumanTCCCTTGCGATTTAC
TotalSeq™-A49CD3SK7HumanTATCCCTTGGGATGG
TotalSeq™-A50CD19HIB19HumanCTGGGCAATTACTCG
TotalSeq™-A51CD1463D3HumanCAATCAGACCTATGA
TotalSeq™-A52CD33P67.6HumanTAACTCAGGGCCTAT
TotalSeq™-A53CD11cS-HCL-3HumanTACGCCTATAACTTG
TotalSeq™-A54CD34581HumanGCAGAAATCTCCCTT
TotalSeq™-A55CD138MI15HumanACTCTTTCGTTTACG
TotalSeq™-A56CD26919F2HumanCAGATGATCCACCAT
TotalSeq™-A57b2-microglobulin2M2HumanCAGCCCGATTAAGGT
TotalSeq™-A58HLA-A,B,CW6/32HumanTATGCGAGGCTTATC
TotalSeq™-A60CD90 (Thy1)5E10HumanGCATTGTACGATTCA
TotalSeq™-A61CD117 (c-kit)104D2HumanAGACTAATAGCTGAC
TotalSeq™-A62CD10HI10aHumanCAGCCATTCATTAGG
TotalSeq™-A63CD45RAHI100HumanTCAATCCTTCCGCTT
TotalSeq™-A64CD1236H6HumanCTTCACTCTGTCAGG
TotalSeq™-A66CD7CD7-6B7HumanTGGATTCCCGGACTT
TotalSeq™-A68CD10543A3HumanATCGTCGAGAGCTAG
TotalSeq™-A69CD201 (EPCR)RCR-401HumanGTTTCCTTGACCAAG
TotalSeq™-A70CD49fGoH3HumanTTCCGAGGATGATCT
TotalSeq™-A71CD194 (CCR4) L291H4HumanAGCTTACCTGCACGA
TotalSeq™-A72CD4RPA-T4HumanTGTTCCCGCTCAACT
TotalSeq™-A73CD44IM7MouseTGGCTTCAGGTCCTA
TotalSeq™-A74CD54YN1/1.7.4MouseATAACCGACACAGTG
TotalSeq™-A75CD90.230-H12MouseCCGATCAGCCGTTTA
TotalSeq™-A77CD73TY/11.8MouseACACTTAACGTCTGG
TotalSeq™-A78CD49dR1-2MouseCGCTTGGACGCTTAA
TotalSeq™-A79CD200 (OX2)OX-90MouseTCAATTCCGGTAGTC
TotalSeq™-A80CD8aRPA-T8HumanGCTGCGCTTTCCATT
TotalSeq™-A81CD14M5E2HumanTCTCAGACCTCCGTA
TotalSeq™-A83CD163G8HumanAAGTTCACTCTTTGC
TotalSeq™-A84CD56QA17A16HumanTTCGCCGCATTGAGT
TotalSeq™-A85CD25BC96HumanTTTGTCCTGTACGCC
TotalSeq™-A87CD45ROUCHL1HumanCTCCGAATCATGTTG
TotalSeq™-A88CD279 (PD-1)EH12.2H7HumanACAGCGCCGTATTTA
TotalSeq™-A89TIGITA15153GHumanTTGCTTACCGCCAGA
TotalSeq™-A90Mouse IgG1, κ isotype CtrlMOPC-21GCCGGACGACATTAA
TotalSeq™-A91Mouse IgG2a, κ isotype CtrlMOPC-173CTCCTACCTAAACTG
TotalSeq™-A92Mouse IgG2b, k Isotype CtrlMPC-11ATATGTATCACGCGA
TotalSeq™-A93CD196D5MouseATCAGCCATGTCAGT
TotalSeq™-A94CD3ε145-2C11MouseTAATGCCAGTTGTGC
TotalSeq™-A95Rat IgG2b, κ Isotype CtrlRTK4530GATTCTTGACGACCT
TotalSeq™-A96CD4530-F11MouseTGGCTATGGAGCAGA
TotalSeq™-A97CD25PC61MouseACCATGAGACACAGT
TotalSeq™-A98CD135A2F10MouseGTAGCAAGATTCAAG
TotalSeq™-A100CD202H7HumanTTCTGGGTCCCTAGA
TotalSeq™-A101CD335 (NKp46)9E2HumanACAATTTGAACAGCG
TotalSeq™-A102CD294BM16HumanTGTTTACGAGAGCCC
TotalSeq™-A103CD45R/B220RA3-6B2MouseCCTACACCTCATAAT
TotalSeq™-A104CD1023C4(MIC2/4)MouseGATATTCAGTGCGAC
TotalSeq™-A105CD115AFS98MouseTTCCGTTGTTGTGAG
TotalSeq™-A106CD11cN418MouseGTTATGGACGCTTGC
TotalSeq™-A107CD21/CD35 (CR2/CR1)7E9MouseGGATAATTTCGATCC
TotalSeq™-A108CD23B3B4MouseTCTCTTGGAAGATGA
TotalSeq™-A109CD16/3293MouseTTCGATGCTGGAGCA
TotalSeq™-A110CD43S11MouseTTGGAGGGTTGTGCT
TotalSeq™-A111CD553-7.3MouseCAGCTCAGTGTGTTG
TotalSeq™-A112CD62LMEL-14MouseTGGGCCTAAGTCATC
TotalSeq™-A113CD93AA4.1MouseGGTATTTCCTGTGGT
TotalSeq™-A114F4/80BM8MouseTTAACTTCAGCCCGT
TotalSeq™-A115FcεRIα1-MarMouseAGTCACCTCGAAGCT
TotalSeq™-A116Ly-6G/Ly-6C (Gr-1)RB6-8C5MouseTAGTGTATGGACACG
TotalSeq™-A117I-A/I-EM5/114.15.2MouseGGTCACCAGTATGAT
TotalSeq™-A118NK-1.1PK136MouseGTAACATTACTCGTC
TotalSeq™-A119Siglec H551MouseCCGCACCTACATTAG
TotalSeq™-A120TCR β chain H57-597MouseTCCTATGGGACTCAG
TotalSeq™-A121TCR γ/δGL3MouseAACCCAAATAGCTGA
TotalSeq™-A122TER-119/Erythroid CellsTER-119MouseGCGCGTTTGTGCTAT
TotalSeq™-A123CD326 (Ep-CAM)9C4HumanTTCCGAGCAAGTATC
TotalSeq™-A124CD31WM59HumanACCTTTATGCCACGG
TotalSeq™-A125CD44BJ18HumanAATCCTTCCGAATGT
TotalSeq™-A126CD133Clone 7HumanTGGTAACGACAGTCC
TotalSeq™-A127PodoplaninNC-08HumanGGTTACTCGTTGTGT
TotalSeq™-A128CD140a16A1HumanATGCGCCGAGAATTA
TotalSeq™-A129CD140b18A2HumanCAATGGTTCACTGCC
TotalSeq™-A130Ly-6A/E (Sca-1)D7MouseTTCCTTTCCTACGCA
TotalSeq™-A131Cadherin 1116G5HumanCGTTGCCATTAACCA
TotalSeq™-A132EGFRAY13HumanGCTTAACATTGGCAC
TotalSeq™-A133CD340 (erbB2/HER-2)24D2HumanCTGTAGCCGCCTATT
TotalSeq™-A134CD146P1H12HumanCCTTGGATAACATCA
TotalSeq™-A135CD324 (E-Cadherin)67A4HumanATCCTTCTCCCTTTC
TotalSeq™-A136IgMMHM-88HumanTAGCGAGCCCGTATA
TotalSeq™-A138CD5UCHT2HumanCATTAACGGGATGCC
TotalSeq™-A139TCR γ/δB1HumanCTTCCGATTCATTCA
TotalSeq™-A140CD183 (CXCR3)G025H7HumanGCGATGGTAGATTAT
TotalSeq™-A141CD195J418F1HumanCCAAAGTAAGAGCCA
TotalSeq™-A142CD32FUN-2HumanGCTTCCGAATTACCG
TotalSeq™-A143CD196G034E3HumanGATCCCTTTGTCACT
TotalSeq™-A144CD185J252D4HumanAATTCAACCGTCGCC
TotalSeq™-A145CD103Ber-ACT8HumanGACCTCATTGTGAAT
TotalSeq™-A146CD69FN50HumanGTCTCTTGGCTTAAA
TotalSeq™-A147CD62LDREG-56HumanGTCCCTGCAACTTGA
TotalSeq™-A148CD197 (CCR7)G043H7HumanAGTTCAGTCAACCGA
TotalSeq™-A149CD161HP-3G10HumanGTACGCAGTCCTTCT
TotalSeq™-A151CD152 (CTLA-4)BNI3HumanATGGTTCACGTAATC
TotalSeq™-A152CD22311C3C65HumanCATTTGTCTGCCGGT
TotalSeq™-A153KLRG1 (MAFA)SA231A2HumanCTTATTTCCTGCCCT
TotalSeq™-A154CD27O323HumanGCACTCCTGCATGTA
TotalSeq™-A155CD107a (LAMP-1) H4A3HumanCAGCCCACTGCAATA
TotalSeq™-A156CD95DX2HumanCCAGCTCATTAGAGC
TotalSeq™-A157CD45.2104MouseCACCGTCATTCAACC
TotalSeq™-A158CD134Ber-ACT35HumanAACCCACCGTTGTTA
TotalSeq™-A159HLA-DRL243HumanAATAGCGAGCAAGTA
TotalSeq™-A160CD1cL161HumanGAGCTACTTCACTCG
TotalSeq™-A161CD11bICRF44HumanGACAAGTGATCTGCA
TotalSeq™-A162CD6410.1HumanAAGTATGCCCTACGA
TotalSeq™-A163CD141M80HumanGGATAACCGCGCTTT
TotalSeq™-A164CD1d51.1HumanTCGAGTCGCTTATCA
TotalSeq™-A165CD314 (NKG2D) 1D11HumanCGTGTTTGTTCCTCA
TotalSeq™-A166CD66b6/40cHumanAGCTGTAAGTTTCGG
TotalSeq™-A167CD35E11HumanACTTCCGTCGATCTT
TotalSeq™-A168CD57QA17A04HumanAACTCCCTATGGAGG
TotalSeq™-A169CD366 (Tim-3)F38-2E2HumanTGTCCTACCCAACTT
TotalSeq™-A170BTLAMIH26HumanGTTATTGGACTAAGG
TotalSeq™-A171CD278 (ICOS) C398.4AHumanCGCGCACCCATTAAA
TotalSeq™-A172CD275 (B7-H2, B7-RP1, ICOSL)9F.8A4HumanGTTAGTGTTAGCTTG
TotalSeq™-A173CD206 (MMR)C068C2HumanTCAACTCGGTGTTGC
TotalSeq™-A174CD58TS2/9HumanGTTCCTATGGACGAC
TotalSeq™-A175CD96NK92.39HumanTGGCCTATAAATGGT
TotalSeq™-A176CD39A1HumanTTACCTGGTATCCGT
TotalSeq™-A177CD178 (Fas-L)NOK-1HumanCCGGTCCTCTGTATT
TotalSeq™-A178CD45.1A20MouseCCTATGGACTTGGAC
TotalSeq™-A179CX3CR1/GPR13/CCRL1K0124E1HumanAGTATCGTCTCTGGG
TotalSeq™-A180CD24ML5HumanAGATTCCTTCGTGTT
TotalSeq™-A181CD21Bu32HumanAACCTAGTAGTTCGG
TotalSeq™-A182CD317A2MouseGTATGTCCGCTCGAT
TotalSeq™-A184CD33529A1.4MouseCCCTTTCACCTCGAA
TotalSeq™-A185CD11aTS2/4HumanTATATCCTTGTGAGC
TotalSeq™-A186IgAHP6123HumanAAGATGTCCGAGCAA
TotalSeq™-A187CD79bCB3-1HumanATTCTTCAACCGAAG
TotalSeq™-A188CD66a/c/eASL-32HumanGGGACAGTTCGTTTC
TotalSeq™-A189CD244 (2B4)C1.7HumanTCGCTTGGATGGTAG
TotalSeq™-A190CD274 (BH-H1, PD-L1)MIH6MouseTCGATTCCACCAACT
TotalSeq™-A191CD27LG.3A10MouseCAAGGTATGTCACTG
TotalSeq™-A192CD20SA275A11MouseTCCACTCCCTGTATA
TotalSeq™-A193CD357 (GITR) DTA-1MouseGGCACTCTGTAACAT
TotalSeq™-A194CD13717B5MouseTCCCTGTATAGATGA
TotalSeq™-A195CD134 (OX-40)OX-86MouseCTCACCTACCTATGG
TotalSeq™-A196CD235abHIR2HumanGCTCCTTTACACGTA
TotalSeq™-A197CD69H1.2F3MouseTTGTATTCCGCCATT
TotalSeq™-A198CD127 (IL-7Rα) A7R34MouseGTGTGAGGCACTCTT
TotalSeq™-A199Siglec-87C9HumanCTTCTCCTCAGCAAT
TotalSeq™-A200CD86GL-1MouseCTGGATTTGTGTATC
TotalSeq™-A201CD1032E7MouseTTCATTAGCCCGCTG
TotalSeq™-A202CD64 (FcγRI) X54-5/7.1MouseAGCAATTAACGGGAG
TotalSeq™-A203CD150 (SLAM) TC15-12F12.2MouseCAACGCCTAGAAACC
TotalSeq™-A204CD2837.51MouseATTAAGAGCGTGTTG
TotalSeq™-A352FcεRIαAER-37(CRA-1)HumanCTCGTTTCCGTATCG
TotalSeq™-A354TCR Vβ5.1, 5.2MR9-4MouseCTCAACAGTATTCTG
TotalSeq™-A355CD137 (4-1BB)4B4-1HumanCAGTAAGTTCGGGAC
TotalSeq™-A356CD254 (TRANCE, RANKL) MIH24HumanTCCGTGTTAGTTTGT
TotalSeq™-A358CD163GHI/61HumanGCTTCTCCTTCCTTA
TotalSeq™-A359CD83HB15eHumanCCACTCATTTCCGGT
TotalSeq™-A360CD357 (GITR)108-17HumanACCTTTCGACACTCG
TotalSeq™-A361CD59p282 (H19)HumanAATTAGCCGTCGAGA
TotalSeq™-A363CD124 (IL-4Rα) G077F6HumanCCGTCCTGATAGATG
TotalSeq™-A364CD13WM15HumanTTTCAACGCCCTTTC
TotalSeq™-A366CD184 (CXCR4)12G5HumanTCAGGTCCTTTCAAC
TotalSeq™-A367CD2TS1/8HumanTACGATTTGTCAGGG
TotalSeq™-A368CD226 (DNAM-1)11A8HumanTCTCAGTGTTTGTGG
TotalSeq™-A369CD29TS2/16HumanGTATTCCCTCAGTCA
TotalSeq™-A370CD303 (BDCA-2)201AHumanGAGATGTCCGAATTT
TotalSeq™-A371CD49bP1E6-C5HumanGCTTTCTTCAGTATG
TotalSeq™-A372CD61VI-PL2HumanAGGTTGGAGTAGACT
TotalSeq™-A373CD81 (TAPA-1)5A6HumanGTATCCTTCCTTGGC
TotalSeq™-A374CD98MEM-108HumanGCACCAACAGCCATT
TotalSeq™-A375IgG Fc M1310G05HumanCTGGAGCGATTAGAA
TotalSeq™-A384IgDIA6-2HumanCAGTCTCCGTAGAGT
TotalSeq™-A385CD18TS1/18HumanTATTGGGACACTTCT
TotalSeq™-A386CD28CD28.2HumanTGAGAACGACCCTAA
TotalSeq™-A387TSLPR (TSLP-R)1D3HumanCAGTCCTCTCTGTCA
TotalSeq™-A389CD38HIT2HumanTGTACCCGCTTGTGA
TotalSeq™-A390CD127 (IL-7Rα)A019D5HumanGTGTGTTGTCCTATG
TotalSeq™-A391CD45HI30HumanTGCAATTACCCGGAT
TotalSeq™-A392CD15W6D3HumanTCACCAGTACCTAGT
TotalSeq™-A393CD22S-HCL-1HumanGGGTTGTTGTCTTTG
TotalSeq™-A394CD71CY1G4HumanCCGTGTTCCTCATTA
TotalSeq™-A395B7-H4MIH43HumanTGTATGTCTGCCTTG
TotalSeq™-A396CD26BA5bHumanGGTGGCTAGATAATG
We are glad to see that you are just as excited as we are to launch this new product line. As we build our portfolio of oligo conjugated antibodies we are collecting information regarding clone and target preferences so we can prioritize our pipeline. Please use this form to tell us which targets, clones and applications you would be interested to see in our catalog.

       (*denotes required field)

*First Name
*Last Name
Job Title
PI Name
*Institution
Address 1
Address 2
City
*Country
State
Postal/Zip Code
Phone Number
*Email Address
Accelerate your discovery with BioLegend.
*Sign up for New Product and Promotion emails:
Your personal data will be handled according to our Privacy Policy. We will never sell your data to anyone. To view, edit, or delete your preferences or personal information, please fill out our Privacy Request Form.

Notes on using the form.
Our standard size is 10µg. We can provide other sizes upon request. Please indicate in the appropriate fields other specific requirements such as required formulation, concentration, etc.
Select application:
Target molecule:
Biolegend clone:
parent clone options
     Privacy Policy
Login/Register
Forgot your password? Reset Password
Request an Account