BioLegend TotalSeq
Antibody-oligonucleotide conjugates are required in a number of expanding applications, particularly in single cell multiomics where extensive data sets can be generated at the molecular level from a single cell. Cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) combines scRNA-Seq and Proteomics in one application, to quantify RNA and protein at the same time. This page explores the capabilities of custom antibody-oligo conjugations, and their applications.

TotalSeq™ format antibodies are BioLegend’s proprietary patent pending technology. Contact us if you are interested in partnering with us around this technology.
TotalSeq™ Barcodes   Overview   CITE-seq workflow and data   Cell Hashing   Inquiry Form
View and Order
TotalSeq™ Products…
Jump to Antibody and
Barcode information
Our first offering, TotalSeq™-A, was designed for use with multiple single-cell sequencing platforms that rely on PolyA capture/priming for cell barcoding. Our latest formats, TotalSeq™-B and TotalSeq™-C, are being co-developed with 10x Genomics for fully supported use with the upcoming 10x Genomics' Chromium Single Cell Gene Expression and Single Cell Immune Profiling Solutions with Feature Barcoding Technology.

Summary of TotalSeq™ formats:
 TotalSeq™-ATotalSeq™-BTotalSeq™-C
10x Genomics compatibilitySingle Cell Gene Expression Solution (3’, v2) and any system employing the poly-A tail capture methodFully supported use with the Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1Fully supported use with the Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1
PCR handleCCTTGGCACCCGAGAATTCCAComing SoonComing Soon
3' flankingB (A)30*A*A 2, 3Coming SoonComing Soon
Next Generation Sequencing compatibilityCompatible with Illumina instrumentsCompatible with Illumina instrumentsCompatible with Illumina instruments
Notes:
  1. 10x Genomics Data Analysis Software does not support cell hashing analysis
  2. The letter B represents G, C, or T.
  3. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.
Currently, products are guaranteed for 4 months. As we continue to work with this product line, guarantee time will be extended in the future.

Barcodes are placed between the PCR handle and the 3' flanking sequence, and they are clone-specific. 10x Genomics Solutions compatible with TotalSeq™-B and TotalSeq™-C contain all the necessary reagents to process and amplify the oligos derived from BioLegend's products for subsequent Illumina sequencing, meaning there is material to accommodate both RNA and antibody-derived tags (ADT) libraries.

For TotalSeq™-A use on the current Single Cell Gene Expression Solution (Single Cell 3' v2), additional reagents for preparation of ADT libraries must be purchased. Please refer to our protocols (General TotalSeq™ and Hashtags) for a detailed reagent list.
Search by specificity or clone name

Download Table
CategoryBarcode ▼Specificity ▼Clone ▼Reactivity ▼Barcode sequence
TotalSeq™-A0001CD4RM4-5MouseAACAAGACCCTTGAG
TotalSeq™-A0002CD8a53-6.7MouseTACCCGTAATAGCGT
TotalSeq™-A0003CD366 (Tim-3)RMT3-23MouseATTGGCACTCAGATG
TotalSeq™-A0004CD279 (PD-1)RMP1-30MouseGAAAGTCAAAGCACT
TotalSeq™-A0005CD802D10HumanACGAATCAATCTGTG
TotalSeq™-A0006CD86IT2.2HumanGTCTTTGTCAGTGCA
TotalSeq™-A0007CD274 (B7-H1, PD-L1)29E.2A3HumanGTTGTCCGACAATAC
TotalSeq™-A0008CD273 (B7-DC, PD-L2)24F.10C12HumanTCAACGCTTGGCTAG
TotalSeq™-A0009CD275 (B7-H2, ICOSL)2D3HumanGTGCATTCAACAGTA
TotalSeq™-A0010CD276 (B7-H3)DCN.70HumanGACTGGGAGGGTATT
TotalSeq™-A0012CD117 (c-kit)2B8MouseTGCATGTCATCGGTG
TotalSeq™-A0013Ly-6CHK1.4MouseAAGTCGTGAGGCATG
TotalSeq™-A0014CD11bM1/70Human, MouseTGAAGGCTCATTTGT
TotalSeq™-A0015Ly-6G1A8MouseACATTGACGCAACTA
TotalSeq™-A0016Galectin-99M1-3HumanACTCACTGGAGTCTC
TotalSeq™-A0020CD270 (HVEM, TR2)122HumanTGATAGAAACAGACC
TotalSeq™-A0021CD252 (OX40L)11C3.1HumanTTTAGTGATCCGACT
TotalSeq™-A0022CD137L (4-1BB Ligand)5F4HumanATTCGCCTTACGCAA
TotalSeq™-A0023CD155 (PVR)SKII.4HumanATCACATCGTTGCCA
TotalSeq™-A0024CD112 (Nectin-2)TX31HumanAACCTTCCGTCTAAG
TotalSeq™-A0025Annexin VNAHumanGCAGCGTATAAGTCA
TotalSeq™-A0026CD47CC2C6HumanGCATTCTGTCACCTA
TotalSeq™-A0027CD70113-16HumanCGCGAACATAAGAAG
TotalSeq™-A0028CD30BY88HumanTCAGGGTGTGCTGTA
TotalSeq™-A0029CD48BJ40HumanCTACGACGTAGAAGA
TotalSeq™-A0030CD277 (BT3.1)BT3.1HumanTACTTCTGGAGCCAG
TotalSeq™-A0031CD405C3HumanCTCAGATGGAGTATG
TotalSeq™-A0032CD15424-31HumanGCTAGATAGATGCAA
TotalSeq™-A0033CD52HI186HumanCTTTGTACGAGCAAA
TotalSeq™-A0034CD3UCHT1HumanCTCATTGTAACTCCT
TotalSeq™-A0045CD4SK3HumanGAGGTTAGTGATGGA
TotalSeq™-A0046CD8SK1HumanGCGCAACTTGATGAT
TotalSeq™-A0047CD56 (NCAM)5.1H11HumanTCCTTTCCTGATAGG
TotalSeq™-A0048CD452D1HumanTCCCTTGCGATTTAC
TotalSeq™-A0049CD3SK7HumanTATCCCTTGGGATGG
TotalSeq™-A0050CD19HIB19HumanCTGGGCAATTACTCG
TotalSeq™-A0051CD1463D3HumanCAATCAGACCTATGA
TotalSeq™-A0052CD33P67.6HumanTAACTCAGGGCCTAT
TotalSeq™-A0053CD11cS-HCL-3HumanTACGCCTATAACTTG
TotalSeq™-A0054CD34581HumanGCAGAAATCTCCCTT
TotalSeq™-A0055CD138 (Syndecan-1)MI15HumanACTCTTTCGTTTACG
TotalSeq™-A0056CD269 (BCMA)19F2HumanCAGATGATCCACCAT
TotalSeq™-A0057β2-microglobulin2M2HumanCAGCCCGATTAAGGT
TotalSeq™-A0058HLA-A,B,CW6/32HumanTATGCGAGGCTTATC
TotalSeq™-A0060CD90 (Thy1)5.00E+10HumanGCATTGTACGATTCA
TotalSeq™-A0061CD117 (c-kit)104D2HumanAGACTAATAGCTGAC
TotalSeq™-A0062CD10HI10aHumanCAGCCATTCATTAGG
TotalSeq™-A0063CD45RAHI100HumanTCAATCCTTCCGCTT
TotalSeq™-A0064CD1236H6HumanCTTCACTCTGTCAGG
TotalSeq™-A0066CD7CD7-6B7HumanTGGATTCCCGGACTT
TotalSeq™-A0068CD10543A3HumanATCGTCGAGAGCTAG
TotalSeq™-A0069CD201 (EPCR)RCR-401HumanGTTTCCTTGACCAAG
TotalSeq™-A0070CD49fGoH3Human, MouseTTCCGAGGATGATCT
TotalSeq™-A0071CD194 (CCR4)L291H4HumanAGCTTACCTGCACGA
TotalSeq™-A0072CD4RPA-T4HumanTGTTCCCGCTCAACT
TotalSeq™-A0073CD44IM7Human, MouseTGGCTTCAGGTCCTA
TotalSeq™-A0074CD54YN1/1.7.4MouseATAACCGACACAGTG
TotalSeq™-A0075CD90.230-H12MouseCCGATCAGCCGTTTA
TotalSeq™-A0076CD15 (SSEA-1)MC-480Human, MouseGCTAGTTTGTGCTGC
TotalSeq™-A0077CD73TY/11.8MouseACACTTAACGTCTGG
TotalSeq™-A0078CD49dR1-2MouseCGCTTGGACGCTTAA
TotalSeq™-A0079CD200 (OX2)OX-90MouseTCAATTCCGGTAGTC
TotalSeq™-A0080CD8aRPA-T8HumanGCTGCGCTTTCCATT
TotalSeq™-A0081CD14M5E2HumanTCTCAGACCTCCGTA
TotalSeq™-A0083CD163G8HumanAAGTTCACTCTTTGC
TotalSeq™-A0084CD56 (NCAM) RecombinantQA17A16HumanTTCGCCGCATTGAGT
TotalSeq™-A0085CD25BC96HumanTTTGTCCTGTACGCC
TotalSeq™-A0087CD45ROUCHL1HumanCTCCGAATCATGTTG
TotalSeq™-A0088CD279 (PD-1)EH12.2H7HumanACAGCGCCGTATTTA
TotalSeq™-A0089TIGIT (VSTM3)A15153GHumanTTGCTTACCGCCAGA
TotalSeq™-A0090Mouse IgG1, κ isotype CtrlMOPC-21N/AGCCGGACGACATTAA
TotalSeq™-A0091Mouse IgG2a, κ isotype CtrlMOPC-173N/ACTCCTACCTAAACTG
TotalSeq™-A0092Mouse IgG2b, κ isotype CtrlMPC-11N/AATATGTATCACGCGA
TotalSeq™-A0093CD196D5MouseATCAGCCATGTCAGT
TotalSeq™-A0094CD3ε145-2C11MouseTAATGCCAGTTGTGC
TotalSeq™-A0095Rat IgG2b, κ isotype CtrlRTK4530N/AGATTCTTGACGACCT
TotalSeq™-A0096CD4530-F11MouseTGGCTATGGAGCAGA
TotalSeq™-A0097CD25PC61MouseACCATGAGACACAGT
TotalSeq™-A0098CD135A2F10MouseGTAGCAAGATTCAAG
TotalSeq™-A0100CD202H7HumanTTCTGGGTCCCTAGA
TotalSeq™-A0101CD335 (NKp46)9.00E+02HumanACAATTTGAACAGCG
TotalSeq™-A0102CD294 (CRTH2)BM16HumanTGTTTACGAGAGCCC
TotalSeq™-A0103CD45R/B220RA3-6B2Human, MouseCCTACACCTCATAAT
TotalSeq™-A0104CD1023C4 (MIC2/4)MouseGATATTCAGTGCGAC
TotalSeq™-A0105CD115 (CSF-1R)AFS98MouseTTCCGTTGTTGTGAG
TotalSeq™-A0106CD11cN418MouseGTTATGGACGCTTGC
TotalSeq™-A0107CD21/CD35 (CR2/CR1)7.00E+09MouseGGATAATTTCGATCC
TotalSeq™-A0108CD23B3B4MouseTCTCTTGGAAGATGA
TotalSeq™-A0109CD16/3293MouseTTCGATGCTGGAGCA
TotalSeq™-A0110CD43S11MouseTTGGAGGGTTGTGCT
TotalSeq™-A0111CD553-7.3MouseCAGCTCAGTGTGTTG
TotalSeq™-A0112CD62LMEL-14MouseTGGGCCTAAGTCATC
TotalSeq™-A0113CD93 (AA4.1, early B lineage)AA4.1MouseGGTATTTCCTGTGGT
TotalSeq™-A0114F4/80BM8MouseTTAACTTCAGCCCGT
TotalSeq™-A0115FcεRIα1-MarMouseAGTCACCTCGAAGCT
TotalSeq™-A0116Ly-6G/Ly-6C (Gr-1)RB6-8C5MouseTAGTGTATGGACACG
TotalSeq™-A0117I-A/I-EM5/114.15.2MouseGGTCACCAGTATGAT
TotalSeq™-A0118NK-1.1PK136MouseGTAACATTACTCGTC
TotalSeq™-A0119Siglec H551MouseCCGCACCTACATTAG
TotalSeq™-A0120TCR β chainH57-597MouseTCCTATGGGACTCAG
TotalSeq™-A0121TCR γ/δGL3MouseAACCCAAATAGCTGA
TotalSeq™-A0122TER-119/Erythroid CellsTER-119MouseGCGCGTTTGTGCTAT
TotalSeq™-A0123CD326 (Ep-CAM)9C4HumanTTCCGAGCAAGTATC
TotalSeq™-A0124CD31WM59HumanACCTTTATGCCACGG
TotalSeq™-A0125CD44BJ18HumanAATCCTTCCGAATGT
TotalSeq™-A0126CD133clone 7HumanTGGTAACGACAGTCC
TotalSeq™-A0127PodoplaninNC-08HumanGGTTACTCGTTGTGT
TotalSeq™-A0128CD140a (PDGFRα)16A1HumanATGCGCCGAGAATTA
TotalSeq™-A0129CD140b (PDGFRβ)18A2HumanCAATGGTTCACTGCC
TotalSeq™-A0130Ly-6A/E (Sca-1)D7MouseTTCCTTTCCTACGCA
TotalSeq™-A0131Cadherin 1116G5HumanCGTTGCCATTAACCA
TotalSeq™-A0132EGFRAY13HumanGCTTAACATTGGCAC
TotalSeq™-A0133CD340 (erbB2/HER-2)24D2HumanCTGTAGCCGCCTATT
TotalSeq™-A0134CD146P1H12HumanCCTTGGATAACATCA
TotalSeq™-A0135CD324 (E-Cadherin)67A4HumanATCCTTCTCCCTTTC
TotalSeq™-A0136IgMMHM-88HumanTAGCGAGCCCGTATA
TotalSeq™-A0138CD5UCHT2HumanCATTAACGGGATGCC
TotalSeq™-A0139TCR γ/δB1HumanCTTCCGATTCATTCA
TotalSeq™-A0140CD183 (CXCR3)G025H7HumanGCGATGGTAGATTAT
TotalSeq™-A0141CD195 (CCR5)J418F1HumanCCAAAGTAAGAGCCA
TotalSeq™-A0142CD32FUN-2HumanGCTTCCGAATTACCG
TotalSeq™-A0143CD196 (CCR6)G034E3HumanGATCCCTTTGTCACT
TotalSeq™-A0144CD185 (CXCR5)J252D4HumanAATTCAACCGTCGCC
TotalSeq™-A0145CD103 (Integrin αE)Ber-ACT8HumanGACCTCATTGTGAAT
TotalSeq™-A0146CD69FN50HumanGTCTCTTGGCTTAAA
TotalSeq™-A0147CD62LDREG-56HumanGTCCCTGCAACTTGA
TotalSeq™-A0148CD197 (CCR7)G043H7HumanAGTTCAGTCAACCGA
TotalSeq™-A0149CD161HP-3G10HumanGTACGCAGTCCTTCT
TotalSeq™-A0151CD152 (CTLA-4)BNI3HumanATGGTTCACGTAATC
TotalSeq™-A0152CD223 (LAG-3)11C3C65HumanCATTTGTCTGCCGGT
TotalSeq™-A0153KLRG1 (MAFA)SA231A2HumanCTTATTTCCTGCCCT
TotalSeq™-A0154CD27O323HumanGCACTCCTGCATGTA
TotalSeq™-A0155CD107a (LAMP-1)H4A3HumanCAGCCCACTGCAATA
TotalSeq™-A0156CD95 (Fas)DX2HumanCCAGCTCATTAGAGC
TotalSeq™-A0157CD45.2104MouseCACCGTCATTCAACC
TotalSeq™-A0158CD134 (OX40)Ber-ACT35 (ACT35)HumanAACCCACCGTTGTTA
TotalSeq™-A0159HLA-DRL243HumanAATAGCGAGCAAGTA
TotalSeq™-A0160CD1cL161HumanGAGCTACTTCACTCG
TotalSeq™-A0161CD11bICRF44HumanGACAAGTGATCTGCA
TotalSeq™-A0162CD6410.1HumanAAGTATGCCCTACGA
TotalSeq™-A0163CD141 (Thrombomodulin)M80HumanGGATAACCGCGCTTT
TotalSeq™-A0164CD1d51.1HumanTCGAGTCGCTTATCA
TotalSeq™-A0165CD314 (NKG2D)1D11HumanCGTGTTTGTTCCTCA
TotalSeq™-A0166CD66b6/40cHumanAGCTGTAAGTTTCGG
TotalSeq™-A0167CD35E11HumanACTTCCGTCGATCTT
TotalSeq™-A0168CD57 RecombinantQA17A04HumanAACTCCCTATGGAGG
TotalSeq™-A0169CD366 (Tim-3)F38-2E2HumanTGTCCTACCCAACTT
TotalSeq™-A0170CD272 (BTLA)MIH26HumanGTTATTGGACTAAGG
TotalSeq™-A0171CD278 (ICOS)C398.4AHuman, MouseCGCGCACCCATTAAA
TotalSeq™-A0172CD275 (B7-H2, B7-RP1, ICOSL)9F.8A4HumanGTTAGTGTTAGCTTG
TotalSeq™-A0173CD206 (MMR)C068C2MouseTCAACTCGGTGTTGC
TotalSeq™-A0174CD58 (LFA-3)TS2/9HumanGTTCCTATGGACGAC
TotalSeq™-A0175CD96 (TACTILE)NK92.39HumanTGGCCTATAAATGGT
TotalSeq™-A0176CD39A1HumanTTACCTGGTATCCGT
TotalSeq™-A0177CD178 (Fas-L)NOK-1HumanCCGGTCCTCTGTATT
TotalSeq™-A0178CD45.1A20MouseCCTATGGACTTGGAC
TotalSeq™-A0179CX3CR1K0124E1HumanAGTATCGTCTCTGGG
TotalSeq™-A0180CD24ML5HumanAGATTCCTTCGTGTT
TotalSeq™-A0181CD21Bu32HumanAACCTAGTAGTTCGG
TotalSeq™-A0182CD317A2MouseGTATGTCCGCTCGAT
TotalSeq™-A0184CD335 (NKp46)29A1.4MouseCCCTTTCACCTCGAA
TotalSeq™-A0185CD11aTS2/4HumanTATATCCTTGTGAGC
TotalSeq™-A0186IgAHP6123HumanAAGATGTCCGAGCAA
TotalSeq™-A0187CD79b (Igβ)CB3-1HumanATTCTTCAACCGAAG
TotalSeq™-A0188CD66a/c/eASL-32HumanGGGACAGTTCGTTTC
TotalSeq™-A0189CD244 (2B4)C1.7HumanTCGCTTGGATGGTAG
TotalSeq™-A0190CD274 (B7-H1, PD-L1)MIH6MouseTCGATTCCACCAACT
TotalSeq™-A0191CD27LG.3A10Human, Mouse, RatCAAGGTATGTCACTG
TotalSeq™-A0192CD20SA275A11MouseTCCACTCCCTGTATA
TotalSeq™-A0193CD357 (GITR)DTA-1MouseGGCACTCTGTAACAT
TotalSeq™-A0194CD13717B5MouseTCCCTGTATAGATGA
TotalSeq™-A0195CD134 (OX-40)OX-86MouseCTCACCTACCTATGG
TotalSeq™-A0196CD235abHIR2HumanGCTCCTTTACACGTA
TotalSeq™-A0197CD69H1.2F3MouseTTGTATTCCGCCATT
TotalSeq™-A0198CD127 (IL-7Rα)A7R34MouseGTGTGAGGCACTCTT
TotalSeq™-A0199Siglec-87C9HumanCTTCTCCTCAGCAAT
TotalSeq™-A0200CD86GL-1MouseCTGGATTTGTGTATC
TotalSeq™-A0201CD1032.00E+07MouseTTCATTAGCCCGCTG
TotalSeq™-A0202CD64 (FcγRI)X54-5/7.1MouseAGCAATTAACGGGAG
TotalSeq™-A0203CD150 (SLAM)TC15-12F12.2MouseCAACGCCTAGAAACC
TotalSeq™-A0204CD2837.51MouseATTAAGAGCGTGTTG
TotalSeq™-A0205CD206 (MMR)15-2HumanTCAGAACGTCTAACT
TotalSeq™-A0206CD169 (Sialoadhesin, Siglec-1)7-239HumanTACTCAGCGTGTTTG
TotalSeq™-A0207CD370 (CLEC9A/DNGR1)8F9HumanCTGCATTTCAGTAAG
TotalSeq™-A0208XCR1S15046EHumanAAGACGCATGTCAAC
TotalSeq™-A0209TCR Vγ1.1/Cr42.11MouseTCGTTTAACCAGCCT
TotalSeq™-A0210TCR Vγ3536MouseTCGTGGTCCCTTTCT
TotalSeq™-A0211TCR Vγ2UC3-10A6MouseAAGCTGCACCGTAAT
TotalSeq™-A0212CD24M1/69MouseTATATCTTTGCCGCA
TotalSeq™-A0213Notch 1MHN1-519HumanAATCTGTAGTGCGTT
TotalSeq™-A0214integrin β7FIB504Human, MouseTCCTTGGATGTACCG
TotalSeq™-A0215CD268 (BAFF-R)11C1HumanCGAAGTCGATCCGTA
TotalSeq™-A0216CD42bHIP1HumanTCCTAGTACCGAAGT
TotalSeq™-A0217CD54HA58HumanCTGATAGACTTGAGT
TotalSeq™-A0218CD62P (P-Selectin)AK4HumanCCTTCCGTATCCCTT
TotalSeq™-A0219CD119 (IFN-γ R α chain)GIR-208HumanTGTGTATTCCCTTGT
TotalSeq™-A0220IL-10JES3-12G8HumanACCTTCCTTCCCTGT
TotalSeq™-A0221anti-IRF511F4A09HumanGGTAGCCCTAGAGTA
TotalSeq™-A0223anti-RORγ2F7-2Human, MouseTTCCCTACGCCGAAT
TotalSeq™-A0224TCR α/βIP26HumanCGTAACGTAGAGCGA
TotalSeq™-A0225CD196 (CCR6)29-2L17MouseCTCTCTGCATTCCTC
TotalSeq™-A0226CD106429 (MVCAM.A)MouseCGTTCCTACCTACCT
TotalSeq™-A0227CD122 (IL-2Rβ)5H4MouseGGTATGCGACACTTA
TotalSeq™-A0228CD183 (CXCR3)CXCR3-173MouseGTTCACGCCGTGTTA
TotalSeq™-A0229CD62P (P-selectin)RMP-1Mouse, RatTGTGTGCCGTAGACT
TotalSeq™-A0230CD8b (Ly-3)YTS156.7.7MouseTTCCCTCTATGGAGC
TotalSeq™-A0231H-2Kb bound to SIINFEKL25-D1.16MouseCGTTTATGGGATGGG
TotalSeq™-A0232MAdCAM-1MECA-367MouseTTGGGCGATTAAGAA
TotalSeq™-A0233Notch 3MHN3-21HumanCTATTGGACGTATCT
TotalSeq™-A0234CD68Y1/82AHumanCGGTGTTTGTAGCAA
TotalSeq™-A0235TCR Vβ8.1, 8.2KJ16-133.18MouseACTATCCGTTGTGCT
TotalSeq™-A0236Rat IgG1, κ isotype CtrlRTK2071N/AATCAGATGCCCTCAT
TotalSeq™-A0237Rat IgG1, λ Isotype CtrlG0114F7N/AGGGAGCGATTCAACT
TotalSeq™-A0238Rat IgG2a, κ Isotype CtrlRTK2758N/AAAGTCAGGTTCGTTT
TotalSeq™-A0239anti-rat IgG2aMRG2a-83RatCATTAACAGCGCCAA
TotalSeq™-A0240Rat IgG2c, κ Isotype CtrlRTK4174N/ATCCAGGCTAGTCATT
TotalSeq™-A0241Armenian Hamster IgG Isotype CtrlHTK888N/ACCTGTCATTAAGACT
TotalSeq™-A0242CD192 (CCR2)K036C2HumanGAGTTCCCTTACCTG
TotalSeq™-A0244CD102 (ICAM-2)CBR-IC2/2HumanTGACCTTCCTCTCCT
TotalSeq™-A0245CD106STAHumanTCACAGTTCCTTGGA
TotalSeq™-A0246CD122 (IL-2Rβ)TU27HumanTCATTTCCTCCGATT
TotalSeq™-A0247CD267 (TACI)1A1HumanAGTGATGGAGCGAAC
TotalSeq™-A0248CD62EHAE-1fHumanCTCCCTGTGGCTTAA
TotalSeq™-A0249IRF4IRF4.3E4Human, MouseGGATTTGTATCTCCC
TotalSeq™-A0250KLRG1 (MAFA)2F1/KLRG1Human, MouseGTAGTAGGCTAGACC
TotalSeq™-A0351CD135 (Flt-3/Flk-2)BV10A4H2HumanCAGTAGATGGAGCAT
TotalSeq™-A0352FcεRIαAER-37 (CRA-1)HumanCTCGTTTCCGTATCG
TotalSeq™-A0353CD41HIP8HumanACGTTGTGGCCTTGT
TotalSeq™-A0354TCR Vβ5.1, 5.2MR9-4MouseCTCAACAGTATTCTG
TotalSeq™-A0355CD137 (4-1BB)4B4-1HumanCAGTAAGTTCGGGAC
TotalSeq™-A0356CD254 (TRANCE, RANKL)MIH24HumanTCCGTGTTAGTTTGT
TotalSeq™-A0357CD43CD43-10G7HumanGATTAACCAGCTCAT
TotalSeq™-A0358CD163GHI/61HumanGCTTCTCCTTCCTTA
TotalSeq™-A0359CD83HB15eHumanCCACTCATTTCCGGT
TotalSeq™-A0360CD357 (GITR)108-17HumanACCTTTCGACACTCG
TotalSeq™-A0361CD59p282 (H19)HumanAATTAGCCGTCGAGA
TotalSeq™-A0362CD309 (VEGFR2)7D4-6HumanTTCACGCAGTAAGAT
TotalSeq™-A0363CD124 (IL-4Rα)G077F6HumanCCGTCCTGATAGATG
TotalSeq™-A0364CD13WM15HumanTTTCAACGCCCTTTC
TotalSeq™-A0366CD184 (CXCR4)12G5HumanTCAGGTCCTTTCAAC
TotalSeq™-A0367CD2TS1/8HumanTACGATTTGTCAGGG
TotalSeq™-A0368CD226 (DNAM-1)11A8HumanTCTCAGTGTTTGTGG
TotalSeq™-A0369CD29TS2/16HumanGTATTCCCTCAGTCA
TotalSeq™-A0370CD303 (BDCA-2)201AHumanGAGATGTCCGAATTT
TotalSeq™-A0371CD49bP1E6-C5HumanGCTTTCTTCAGTATG
TotalSeq™-A0372CD61VI-PL2HumanAGGTTGGAGTAGACT
TotalSeq™-A0373CD81 (TAPA-1)5A6HumanGTATCCTTCCTTGGC
TotalSeq™-A0374CD98MEM-108HumanGCACCAACAGCCATT
TotalSeq™-A0375IgG FcM1310G05HumanCTGGAGCGATTAGAA
TotalSeq™-A0376CD195 (CCR5)HM-CCR5MouseACCAGTTGTCATTAC
TotalSeq™-A0377CD197 (CCR7)4B12MouseTTATTAACAGCCCAC
TotalSeq™-A0378CD223 (LAG-3)C9B7WMouseATTCCGTCCCTAAGG
TotalSeq™-A0379CD62E (E-selectin)RME-1/CD62EMouse, RatCTCCCTTTGTAACAT
TotalSeq™-A0380rat CD90/mouse CD90.1OX-7Mouse, RatAGTATGGGATGCAAT
TotalSeq™-A0381Panendothelial Cell AntigenMECA-32MouseCGTCCTAGTCATTGG
TotalSeq™-A0382CD177MEM-166HumanAGTATGGAGCCATAT
TotalSeq™-A0383CD55JS11HumanGCTCATTACCCATTA
TotalSeq™-A0384IgDIA6-2HumanCAGTCTCCGTAGAGT
TotalSeq™-A0385CD18TS1/18HumanTATTGGGACACTTCT
TotalSeq™-A0386CD28CD28.2HumanTGAGAACGACCCTAA
TotalSeq™-A0387TSLPR (TSLP-R)1D3HumanCAGTCCTCTCTGTCA
TotalSeq™-A0388CD152UC10-4B9MouseAGTGTTTGTCCTGGT
TotalSeq™-A0389CD38HIT2HumanTGTACCCGCTTGTGA
TotalSeq™-A0390CD127 (IL-7Rα)A019D5HumanGTGTGTTGTCCTATG
TotalSeq™-A0391CD45HI30HumanTGCAATTACCCGGAT
TotalSeq™-A0392CD15 (SSEA-1)W6D3HumanTCACCAGTACCTAGT
TotalSeq™-A0393CD22S-HCL-1HumanGGGTTGTTGTCTTTG
TotalSeq™-A0394CD71CY1G4HumanCCGTGTTCCTCATTA
TotalSeq™-A0395B7-H4MIH43HumanTGTATGTCTGCCTTG
TotalSeq™-A0396CD26BA5bHumanGGTGGCTAGATAATG
TotalSeq™-A0397CD193 (CCR3)5.00E+08HumanACCAATCCTTTCGTC
TotalSeq™-A0398CD115 (CSF-1R)9-4D2-1E4HumanAATCACGGTCCTTGT
TotalSeq™-A0399CD2047C9C20HumanTAGCGAGCCAGATGT
TotalSeq™-A0400CD144 (VE-Cadherin)BV9HumanTCCACTCATTCTGTA
TotalSeq™-A0401CD301 (CLEC10A)H037G3HumanACCTAGAAATCAGCA
TotalSeq™-A0402CD1aHI149HumanGATCGTGTTGTGTTA
TotalSeq™-A0403CD207 (Langerin)1.00E+03HumanCATTCTTCACGGGAT
TotalSeq™-A0404CD63H5C6HumanGAGATGTCTGCAACT
TotalSeq™-A0405CD284 (TLR4)HTA125HumanGCTTAGCTGTATCCG
TotalSeq™-A0406CD304 (Neuropilin-1)12C2HumanGGACTAAGTTTCGTT
TotalSeq™-A0407CD365-271HumanTTCTTTGCCTTGCCA
TotalSeq™-A0408CD172a (SIRPα)15-414HumanCGTGTTTAACTTGAG
TotalSeq™-A0409CD85g (ILT7)17G10.2HumanTGTCAGTTCCTATGA
TotalSeq™-A0410CD38HB-7HumanCCTATTCCGATTCCG
TotalSeq™-A0415P2RY12S16007DMouseTTGCTTATTTCCGCA
TotalSeq™-A0416CD300LG (Nepmucin)ZAQ5MouseCGGTCCGTATCATTT
TotalSeq™-A0417CD163S15049IMouseGAGCAAGATTAAGAC
TotalSeq™-A0418CD243 (ABCB1)4E3.16HumanTGACCCGACCTTTAG
TotalSeq™-A0419CD723F3HumanCAGTCGTGGTAGATA
TotalSeq™-A0420CD158 (KIR2DL1/S1/S3/S5)HP-MA4HumanTATCAACCAACGCTT
TotalSeq™-A0421CD49bHMa2MouseCGCGTTAGTAGAGTC
TotalSeq™-A0422CD172a (SIRPα)P84MouseGATTCCCTTGTAGCA
TotalSeq™-A0423MERTK590H11G1E3HumanTCCTGCATGTACCCA
TotalSeq™-A0424CD14Sa14-2MouseAACCAACAGTCACGT
TotalSeq™-A0426CD192 (CCR2)SA203G11MouseAGTGCGATCTGCAAC
TotalSeq™-A0427Folate Receptor β (FR-β)94b/FOLR2HumanTGTGGCTAGTCAGTT
TotalSeq™-A0428TIM-49F4HumanCGTCATATAGTATGG
TotalSeq™-A0429CD48HM48-1MouseAGAACCGCCGTAGTT
TotalSeq™-A0430CD171 (LICAM)L1-OV198.5HumanGATGGACGACAATTC
TotalSeq™-A0432anti-CD230 (Prion)3F4HumanCAGGTCCCTTATTTC
TotalSeq™-A0433CD325 (N-Cadherin)8C11HumanCCTTCCCTTTCCTCT
TotalSeq™-A0434anti-Dopamine Receptor D42B9/DRD4Human, MouseTCTCTGCACCGCTTT
TotalSeq™-A0435anti-GABRB3N87/25Human, Mouse, RatGGTGTGAGCAGTTCT
TotalSeq™-A0436anti-Biotin1D4-C5BiotinCGGTATATCAACAGA
TotalSeq™-A0437CD2074C7Human, MouseCGATTTGTATTCCCT
TotalSeq™-A0438KCC2N1/12Human, Mouse, RatGAGCTTGTACCGCTT
TotalSeq™-A0439CD201 (EPCR)RCR-16MouseTATGATCTGCCCTTG
TotalSeq™-A0440CD169/Siglec-13D6.112MouseATTGACGACAGTCAT
TotalSeq™-A0441CD71RI7217MouseACCGACCAGTAGACA
TotalSeq™-A0442Notch 1HMN1-12MouseTCCGGTCACTCAGTA
TotalSeq™-A0443CD41MWReg30MouseACTTGGATGGACACT
TotalSeq™-A0444CXCR4L276F12MouseGTCGTGGTGTTGTTC
TotalSeq™-A0445anti-TMEM119A16075DMouseTCGAACATTTCCAGG
TotalSeq™-A0446CD93VIMD2HumanGCGCTACTTCCTTGA
TotalSeq™-A0447CD200 (OX2)OX-104HumanCACGTAGACCTTTGC
TotalSeq™-A0448CD204 (Scavenger R1)1F8C33MouseAGCTAGACACGTTGT
TotalSeq™-A0449CD326 (Ep-CAM)G8.8MouseACCCGCGTTAGTATG
TotalSeq™-A0450IgMRMM-1MouseAGCTACGCATTCAAT
TotalSeq™-A0551CD301aLOM-8.7MouseTGTATTTACTCACCG
TotalSeq™-A0552CD304 (Neuropilin-1)3.00E+12MouseCCAGCTCATTCAACG
TotalSeq™-A0553CD309 (VEGFR2, Flk-1)Avas12MouseATAAGAGCCCACCAT
TotalSeq™-A0554CD309 (VEGFR2, Flk-1)89B3A5MouseAGTTGTCCTGTACGA
TotalSeq™-A0555CD36HM36MouseTTTGCCGCTACGACA
TotalSeq™-A0556CD370 (CLEC9A, DNGR1)7H11MouseAACTCAGTTGTGCCG
TotalSeq™-A0557CD3890MouseCGTATCCGTCTCCTA
TotalSeq™-A0558CD55 (DAF)RIKO-3MouseATTGTTGTCAGACCA
TotalSeq™-A0559CD63NVG-2MouseATCCGACACGTATTA
TotalSeq™-A0560CD68FA-11MouseCTTTCTTTCACGGGA
TotalSeq™-A0561CD79b (Igβ)HM79-12MouseTAACTCAGTGCGAGT
TotalSeq™-A0562CD83Michel-19MouseTCTCAGGCTTCCTAG
TotalSeq™-A0563CX3CR1SA011F11MouseCACTCTCAGTCCTAT
TotalSeq™-A0564Folate Receptor β (FR-β)10/FR2MouseCTCAGATGCCCTTTA
TotalSeq™-A0565MERTK (Mer)2B10C42MouseAGTAGAGCAACTCGT
TotalSeq™-A0566CD301bURA-1MouseCTTGCCTTGCGATTT
TotalSeq™-A0567Tim-4RMT4-54MouseTGCTGGAGGGTATTC
TotalSeq™-A0568XCR1ZETMouse, RatTCCATTACCCACGTT
TotalSeq™-A0569CD338 (ABCG2)5D3HumanTAAGACTTGGCCGTC
TotalSeq™-A0570CD29HMβ1-1Mouse, RatACGCATTCCTTGTGT
TotalSeq™-A0571IgD11-26c.2aMouseTCATATCCGTTGTCC
TotalSeq™-A0572C5L21D9-M12HumanACAATTTGTCTGCGA
TotalSeq™-A0573CD140aAPA5MouseGTCATTGCGGTCCTA
TotalSeq™-A0574CD235a (Glycophorin A)HI264HumanAGAGTATGTATGGGA
TotalSeq™-A0575CD49aTS2/7HumanACTGATGGACTCAGA
TotalSeq™-A0576CD49d9F10HumanCCATTCAACTTCCGG
TotalSeq™-A0577CD73 (Ecto-5'-nucleotidase)AD2HumanCAGTTCCTCAGTTCG
TotalSeq™-A0578CD79a (Igα)HM47HumanCTTATCACCCGCTTT
TotalSeq™-A0579CD9HI9aHumanGAGTCACCAATCTGC
TotalSeq™-A0580mast cell tryptaseAA1HumanACTGATAGACCCGCT
TotalSeq™-A0581TCR Vα7.23C10HumanTACGAGCAGTATTCA
TotalSeq™-A0582TCR Vδ2B6HumanTCAGTCAGATGGTAT
TotalSeq™-A0583TCR Vγ9B3HumanAAGTGATGGTATCTG
TotalSeq™-A0584TCR Vα24-Jα18 (iNKT cell)6B11HumanAACTTCTGTGGTAGC
TotalSeq™-A0586CD354 (TREM-1)TREM-26HumanTAGCCGTTTCCTTTG
TotalSeq™-A0588CD202b (Tie2/Tek)33.1 (Ab33)HumanCGATCCCTTACCTAT
TotalSeq™-A0589Ly-6D49-H4MouseATGTCCTACCTCAAA
TotalSeq™-A0590CD305 (LAIR1)NKTA255HumanATTTCCATTCCCTGT
TotalSeq™-A0591LOX-115C4HumanACCCTTTACCGAATA
TotalSeq™-A0592CD158b (KIR2DL2/L3, NKAT2)DX27HumanGACCCGTAGTTTGAT
TotalSeq™-A0594CD133S16016BHumanGTAAGACGCCTATGC
TotalSeq™-A0595CD11aM17/4MouseAGAGTCTCCCTTTAG
TotalSeq™-A0596ESAM1G8/ESAMMouseTATAGTTTCCGCCGT
TotalSeq™-A0597CD209 (DC-SIGN)9E9A8HumanTCACTGGACACTTAA
TotalSeq™-A0598CD110S16017EHumanTGTTGTAAGATGCCA
TotalSeq™-A0599CD158e1 (KIR3DL1, NKB1)DX9HumanGGACGCTTTCCTTGA
TotalSeq™-A0600CD158f (KIR2DL5)UP-R1HumanAAAGTGATGCCACTG
TotalSeq™-A0801CD337 (NKp30)P30-15HumanAAAGTCACTCTGCCG
TotalSeq™-A0802CD336 (NKp44)P44-8HumanGGGCAATTAGCGAGT
TotalSeq™-A0803CD253 (Trail)RIK-2HumanGCCATTCCTGCCTAA
TotalSeq™-A0804CD186 (CXCR6)K041E5HumanGACAGTCGATGCAAC
TotalSeq™-A0805CD226 (DNAM-1)TX25HumanAGACCAACTCATTCA
We are glad to see that you are just as excited as we are to launch this new product line. As we build our portfolio of oligo conjugated antibodies we are collecting information regarding clone and target preferences so we can prioritize our pipeline. Please use this form to tell us about your oligo-antibody project. A BioLegend representative will contact you to discuss your request.

       (*denotes required field)

*First Name
*Last Name
Job Title
PI Name
*Institution
Address 1
Address 2
City
*Country
State
Postal/Zip Code
Phone Number
*Email Address
Comments
Accelerate your discovery with BioLegend.
*Sign up for New Product and Promotion emails:
Your personal data will be handled according to our Privacy Policy. We will never sell your data to anyone. To view, edit, or delete your preferences or personal information, please fill out our Privacy Request Form.
     Privacy Policy
Login/Register
Forgot your password? Reset Password
Request an Account