- Clone
- 5E10 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- Thy-1, Thy1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCATTGTACGATTCA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
328149 | 10 µg | 296€ |
CD90 is a 25-35 kD GPI-anchored protein, also known as Thy-1. It belongs to the Ig superfamily. Human CD90 is expressed on neuronal cells, a subset of CD34+ cells, a subset of fetal liver cells and fetal thymocytes, fibroblasts, activated endothelial cells, and some leukemia cell lines. CD34+CD90+ cells are primitive hematopoietic stem cells. It has been reported that Thy-1 binds with β2 and β3 integrins and plays bimodal roles in the regulation of cell adhesion and neurite outgrowth, and inhibits hematopoietic stem cells proliferation and differentiation.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Pigtailed Macaque, Rhesus, Pig
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- HEL cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone 5E10 recognizes an epitope on Thy-1 independent of its glycosylation, but is abolished under reducing conditions.4 Additional reported (for the relevant formats) applications include: immunohistochemical staining of acetone-fixed frozen sections, immunoprecipitation1, and immunofluorescence3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Craig W, et al. 1993. J. Exp. Med. 177:1331. (IP)
- Gundlach CW 4th, et al. 2011. Bioconjug. Chem. 22:1706. (Pig Reactivity)
- Touboul C, et al. 2013. J. Transl. Med. 11:28. (IF)
- Bradley JE, et al. 2013. Lab Invest. 93:365. (Epitope)
- Donnenberg VS, et al. 2010. Cytometry B. Clin. Cytom. 5:287. (IHC)
- RRID
-
AB_2904348 (BioLegend Cat. No. 328149)
Antigen Details
- Structure
- 25-35 kD glycoprotein, Ig superfamily
- Distribution
-
Subset of CD34+ hematopoietic stem cells, subset of fetal thymocytes, subset of fetal liver cells, fibroblast, activated endothelial cells, neurons and some leukemia cell lines
- Function
- Regulate hematopoiesis and neural cell growth, cell adhesion
- Ligand/Receptor
- β3 integrin, β2 integrin
- Cell Type
- Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors, Leukemia, Mesenchymal Stem Cells, Neurons, Thymocytes
- Biology Area
- Immunology, Stem Cells
- Molecular Family
- CD Molecules
- Antigen References
-
1. McKenzie JL, et al. 1981. J. Immunol. 126:843.
2. Avalos AM, et al. 2002. Biol. Res. 35:231.
3. Wetzel A, et al. 2004. J. Immunol. 172:3850. - Gene ID
- 7070 View all products for this Gene ID
- UniProt
- View information about CD90 on UniProt.org
Related FAQs
Other Formats
View All CD90 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE/Cyanine7 anti-human CD90 (Thy1)
-
Purified anti-human CD90 (Thy1)
-
Biotin anti-human CD90 (Thy1)
-
FITC anti-human CD90 (Thy1)
-
PE anti-human CD90 (Thy1)
-
PE/Cyanine5 anti-human CD90 (Thy1)
-
APC anti-human CD90 (Thy1)
-
Alexa Fluor® 647 anti-human CD90 (Thy1)
-
PerCP/Cyanine5.5 anti-human CD90 (Thy1)
-
Alexa Fluor® 700 anti-human CD90 (Thy1)
-
Brilliant Violet 421™ anti-human CD90 (Thy1)
-
Brilliant Violet 510™ anti-human CD90 (Thy1)
-
Brilliant Violet 605™ anti-human CD90 (Thy1)
-
Purified anti-human CD90 (Thy1) (Maxpar® Ready)
-
APC/Cyanine7 anti-human CD90 (Thy1)
-
PE/Dazzle™ 594 anti-human CD90 (Thy1)
-
APC/Fire™ 750 anti-human CD90 (Thy1)
-
Brilliant Violet 711™ anti-human CD90 (Thy1)
-
TotalSeq™-A0060 anti-human CD90 (Thy1)
-
Brilliant Violet 785™ anti-human CD90 (Thy1)
-
Brilliant Violet 650™ anti-human CD90 (Thy1)
-
TotalSeq™-C0060 anti-human CD90 (Thy1)
-
TotalSeq™-B0060 anti-human CD90 (Thy1)
-
TotalSeq™-D0060 anti-human CD90 (Thy1)
Follow Us