TotalSeq™-D0031 anti-human CD40 Antibody

Pricing & Availability
Clone
5C3 (See other available formats)
Regulatory Status
RUO
Workshop
V CD40.4
Other Names
BP50, TNFRSF5
Isotype
Mouse IgG1, κ
Barcode Sequence
CTCAGATGGAGTATG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
334354 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD40 is a 48 kD type I glycoprotein also known as BP50. It is a member of the TNFR superfamily primarily expressed on B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts, and at low levels on plasma cells. CD40 has been reported to be involved in B cell differentiation, costimulation, isotype class-switching, and protection of B cells from apoptosis. Additionally, CD40 is important for T cell-B cell interactions. The ligand of CD40 is CD154 (CD40 ligand). The 5C3 antibody has been reported to promote B cell proliferation in the presence of anti-IgM, IL-4 or PMA, partially blocking CD40 binding to CD40L, and B cells rescue from apoptosis.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Chimpanzee, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: costimulation of B cell proliferation1, partial inhibition of CD40 binding to CD40L3, and B cell rescue from apoptosis1. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Schlossman SF, et al. 1995. ed. Leukocyte Typing V:White Cell Differentiation Antigens. New York:Oxford University Press.
  2. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  3. Pound JD, et al. 1999. Int. Immunol. 11:11.
  4. Shey MS, et al. 2014. J Immunol. 192:4833. PubMed
  5. Sondergaard JN, et al. 2014. Mol Immunol. 59:180. PubMed
  6. Saiki O, et al. 1995. J Clin. Invest. 2: 510-4 (Costim)
RRID
AB_2924539 (BioLegend Cat. No. 334354)

Antigen Details

Structure
TNFR superfamily, type I glycoprotein, 48 kD
Distribution

B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts

Function
B cell differentiation, costimulation, isotype class-switching, rescues B cells from apoptosis
Ligand/Receptor
CD154 (CD40 ligand)
Cell Type
B cells, Dendritic cells, Endothelial cells, Fibroblasts, Macrophages
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Banchereau J, et al. 1994. Annu. Rev. Immunol. 12:881.
2. Foy T, et al. 1996. Annu. Rev. Immunol. 14:591.

Gene ID
958 View all products for this Gene ID
UniProt
View information about CD40 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09-02-2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Alexa Fluor® 488 anti-human CD40

  • Purified anti-human CD40

  • FITC anti-human CD40

  • PE anti-human CD40

  • APC anti-human CD40

  • Alexa Fluor® 647 anti-human CD40

  • PerCP/Cyanine5.5 anti-human CD40

  • Pacific Blue™ anti-human CD40

  • PE/Cyanine7 anti-human CD40

  • APC/Cyanine7 anti-human CD40

  • Alexa Fluor® 700 anti-human CD40

  • Purified anti-human CD40 (Maxpar® Ready)

  • Brilliant Violet 510™ anti-human CD40

  • Brilliant Violet 421™ anti-human CD40

  • Brilliant Violet 711™ anti-human CD40

  • Brilliant Violet 605™ anti-human CD40

  • Brilliant Violet 650™ anti-human CD40

  • Brilliant Violet 785™ anti-human CD40

  • PE/Dazzle™ 594 anti-human CD40

  • Biotin anti-human CD40

  • APC/Fire™ 750 anti-human CD40

  • TotalSeq™-A0031 anti-human CD40

  • TotalSeq™-C0031 anti-human CD40

  • Ultra-LEAF™ Purified anti-human CD40

  • TotalSeq™-B0031 anti-human CD40

  • TotalSeq™-D0031 anti-human CD40

  • PE/Fire™ 810 anti-human CD40

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account